Incidental Mutation 'R0622:Olfr600'
ID58730
Institutional Source Beutler Lab
Gene Symbol Olfr600
Ensembl Gene ENSMUSG00000045540
Gene Nameolfactory receptor 600
SynonymsGA_x6K02T2PBJ9-6056235-6055291, MOR39-1
MMRRC Submission 038811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0622 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103343482-103349669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103346857 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 24 (S24P)
Ref Sequence ENSEMBL: ENSMUSP00000148967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056222] [ENSMUST00000215042]
Predicted Effect probably damaging
Transcript: ENSMUST00000056222
AA Change: S24P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053887
Gene: ENSMUSG00000045540
AA Change: S24P

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.1e-97 PFAM
Pfam:7TM_GPCR_Srsx 37 226 1.2e-12 PFAM
Pfam:7tm_1 43 305 7.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215042
AA Change: S24P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Olfr600
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Olfr600 APN 7 103346179 missense probably benign 0.15
IGL02239:Olfr600 APN 7 103346598 missense probably damaging 1.00
IGL02285:Olfr600 APN 7 103346038 nonsense probably null
IGL02547:Olfr600 APN 7 103346244 missense probably damaging 1.00
IGL03149:Olfr600 APN 7 103346849 missense probably benign 0.00
R0193:Olfr600 UTSW 7 103346204 missense possibly damaging 0.74
R0304:Olfr600 UTSW 7 103346711 missense probably damaging 1.00
R0454:Olfr600 UTSW 7 103346878 missense probably benign 0.02
R1988:Olfr600 UTSW 7 103346109 missense possibly damaging 0.88
R1989:Olfr600 UTSW 7 103346109 missense possibly damaging 0.88
R2937:Olfr600 UTSW 7 103346065 missense probably benign 0.18
R4426:Olfr600 UTSW 7 103346083 missense probably damaging 1.00
R5362:Olfr600 UTSW 7 103346247 missense probably damaging 1.00
R5723:Olfr600 UTSW 7 103346619 missense possibly damaging 0.85
R6793:Olfr600 UTSW 7 103346266 missense probably benign 0.00
R6863:Olfr600 UTSW 7 103346916 missense possibly damaging 0.86
R6935:Olfr600 UTSW 7 103346795 missense probably damaging 1.00
R6983:Olfr600 UTSW 7 103346815 missense probably benign 0.00
R7262:Olfr600 UTSW 7 103346557 missense probably damaging 1.00
R7313:Olfr600 UTSW 7 103346331 missense probably benign 0.06
R7774:Olfr600 UTSW 7 103346530 missense possibly damaging 0.85
X0018:Olfr600 UTSW 7 103346899 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCAGGCTTCAAGGCTGATTTC -3'
(R):5'- AGTCGTCCAGAATTTTCTGCATCCC -3'

Sequencing Primer
(F):5'- ATTCCTAGCATTCGGGGTACAG -3'
(R):5'- CCACTCCAAGGAGTTCAAGTATTTAC -3'
Posted On2013-07-11