Incidental Mutation 'R7589:Hip1'
ID587302
Institutional Source Beutler Lab
Gene Symbol Hip1
Ensembl Gene ENSMUSG00000039959
Gene Namehuntingtin interacting protein 1
SynonymsHIP-1, 2610109B09Rik, A930014B11Rik, E130315I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135406531-135545120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135414311 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 956 (D956G)
Ref Sequence ENSEMBL: ENSMUSP00000059033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060311] [ENSMUST00000202643]
Predicted Effect probably benign
Transcript: ENSMUST00000060311
AA Change: D956G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059033
Gene: ENSMUSG00000039959
AA Change: D956G

DomainStartEndE-ValueType
ENTH 38 160 9.98e-41 SMART
PDB:3I00|B 361 480 9e-57 PDB
Pfam:HIP1_clath_bdg 482 572 2.1e-27 PFAM
low complexity region 649 658 N/A INTRINSIC
low complexity region 780 796 N/A INTRINSIC
ILWEQ 806 1004 9.05e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202643
AA Change: D545G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144086
Gene: ENSMUSG00000039959
AA Change: D545G

DomainStartEndE-ValueType
PDB:2QA7|D 1 70 9e-34 PDB
Pfam:HIP1_clath_bdg 71 161 4.4e-24 PFAM
low complexity region 238 247 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
ILWEQ 395 593 5.7e-122 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that functions in clathrin-mediated endocytosis and protein trafficking within the cell. The encoded protein binds to the huntingtin protein in the brain; this interaction is lost in Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutants may exhibit axial skeleton defects, hematopotietic abnormalities, and testicular degeneration with increased apoptosis of postmeiotic spermatids. One line showed microphthalmia and cataracts, whereas others did not. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Hip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Hip1 APN 5 135449822 missense probably damaging 1.00
IGL00418:Hip1 APN 5 135426346 missense probably damaging 1.00
IGL01744:Hip1 APN 5 135545063 utr 5 prime probably benign
IGL02494:Hip1 APN 5 135444791 nonsense probably null
IGL02749:Hip1 APN 5 135444751 missense probably benign 0.00
IGL03219:Hip1 APN 5 135457050 missense probably benign 0.16
IGL03328:Hip1 APN 5 135424874 missense probably damaging 1.00
BB010:Hip1 UTSW 5 135460456 missense probably damaging 0.98
BB020:Hip1 UTSW 5 135460456 missense probably damaging 0.98
R0100:Hip1 UTSW 5 135436453 missense probably benign
R0100:Hip1 UTSW 5 135436453 missense probably benign
R0336:Hip1 UTSW 5 135428613 missense probably benign 0.39
R0410:Hip1 UTSW 5 135458155 missense probably damaging 1.00
R1454:Hip1 UTSW 5 135438632 missense probably benign
R1530:Hip1 UTSW 5 135444780 missense probably damaging 1.00
R1848:Hip1 UTSW 5 135435141 splice site probably null
R2201:Hip1 UTSW 5 135431730 missense probably benign
R2246:Hip1 UTSW 5 135452844 missense probably damaging 1.00
R2276:Hip1 UTSW 5 135457046 missense probably damaging 1.00
R2353:Hip1 UTSW 5 135412712 missense probably damaging 1.00
R3013:Hip1 UTSW 5 135435039 missense possibly damaging 0.91
R3413:Hip1 UTSW 5 135422172 missense probably damaging 1.00
R3939:Hip1 UTSW 5 135428764 missense probably benign 0.14
R4153:Hip1 UTSW 5 135412706 missense probably damaging 1.00
R4839:Hip1 UTSW 5 135426318 splice site probably null
R5059:Hip1 UTSW 5 135449821 missense probably damaging 1.00
R5171:Hip1 UTSW 5 135440302 missense probably damaging 1.00
R5189:Hip1 UTSW 5 135434293 missense probably damaging 1.00
R5358:Hip1 UTSW 5 135436398 missense probably benign 0.22
R5642:Hip1 UTSW 5 135433085 nonsense probably null
R5646:Hip1 UTSW 5 135428741 missense probably damaging 0.98
R5831:Hip1 UTSW 5 135411263 missense probably benign 0.00
R5908:Hip1 UTSW 5 135424863 critical splice donor site probably null
R6484:Hip1 UTSW 5 135440129 missense probably damaging 1.00
R6535:Hip1 UTSW 5 135428497 splice site probably null
R6557:Hip1 UTSW 5 135428719 missense possibly damaging 0.67
R7459:Hip1 UTSW 5 135414297 missense probably damaging 1.00
R7677:Hip1 UTSW 5 135430317 missense probably benign
R7933:Hip1 UTSW 5 135460456 missense probably damaging 0.98
R8267:Hip1 UTSW 5 135428613 missense probably benign 0.39
Z1177:Hip1 UTSW 5 135428606 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACAAGTGCTCTGAACTGCTG -3'
(R):5'- TGCACACTTGTATGTACACAAAGG -3'

Sequencing Primer
(F):5'- CAAGTGCTGGGATTATTACATGCCC -3'
(R):5'- CACTTGTATGTACACAAAGGAAGTCC -3'
Posted On2019-10-24