Incidental Mutation 'R7589:Rnf6'
ID587303
Institutional Source Beutler Lab
Gene Symbol Rnf6
Ensembl Gene ENSMUSG00000029634
Gene Namering finger protein (C3H2C3 type) 6
Synonyms5730419H05Rik, 1200013I08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location146209192-146221555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146211429 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 260 (R260W)
Ref Sequence ENSEMBL: ENSMUSP00000067559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067837] [ENSMUST00000159074] [ENSMUST00000161331] [ENSMUST00000161574] [ENSMUST00000161859] [ENSMUST00000169407]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067837
AA Change: R260W

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067559
Gene: ENSMUSG00000029634
AA Change: R260W

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159074
SMART Domains Protein: ENSMUSP00000123926
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161331
SMART Domains Protein: ENSMUSP00000125611
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161574
SMART Domains Protein: ENSMUSP00000123730
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161859
AA Change: R260W

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124293
Gene: ENSMUSG00000029634
AA Change: R260W

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000123708
Gene: ENSMUSG00000029634
AA Change: R229W

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 157 185 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169407
AA Change: R260W

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128774
Gene: ENSMUSG00000029634
AA Change: R260W

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING-H2 finger motif. Deletions and mutations in this gene were detected in esophageal squamous cell carcinoma (ESCC), suggesting that this protein may be a potential tumor suppressor. Studies of the mouse counterpart suggested a role of this protein in the transcription regulation that controls germinal differentiation. Multiple alternatively spliced transcript variants encoding the same protein are observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Rnf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Rnf6 APN 5 146211905 missense possibly damaging 0.86
IGL01432:Rnf6 APN 5 146216121 missense possibly damaging 0.61
IGL01722:Rnf6 APN 5 146210226 missense probably benign
IGL01866:Rnf6 APN 5 146210907 missense probably damaging 0.99
R0141:Rnf6 UTSW 5 146211835 missense possibly damaging 0.95
R0551:Rnf6 UTSW 5 146211395 missense possibly damaging 0.65
R0619:Rnf6 UTSW 5 146210721 missense possibly damaging 0.58
R0685:Rnf6 UTSW 5 146211658 missense probably damaging 0.99
R1363:Rnf6 UTSW 5 146211559 missense probably benign
R1387:Rnf6 UTSW 5 146211245 missense probably benign 0.00
R1671:Rnf6 UTSW 5 146211188 nonsense probably null
R2047:Rnf6 UTSW 5 146211864 missense probably damaging 0.99
R2074:Rnf6 UTSW 5 146210906 missense probably damaging 0.98
R2107:Rnf6 UTSW 5 146211281 missense probably damaging 0.99
R2871:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2871:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2873:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2874:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R4361:Rnf6 UTSW 5 146211279 missense probably damaging 1.00
R5421:Rnf6 UTSW 5 146210529 missense probably benign 0.06
R5437:Rnf6 UTSW 5 146210280 missense probably damaging 1.00
R5614:Rnf6 UTSW 5 146218100 splice site probably null
R5848:Rnf6 UTSW 5 146211149 missense probably benign 0.25
R7515:Rnf6 UTSW 5 146211792 missense probably damaging 1.00
R7767:Rnf6 UTSW 5 146211176 missense probably damaging 0.98
R7767:Rnf6 UTSW 5 146211177 nonsense probably null
R8155:Rnf6 UTSW 5 146211005 missense probably damaging 0.96
R8205:Rnf6 UTSW 5 146210904 missense probably damaging 0.98
R8302:Rnf6 UTSW 5 146211524 missense probably benign
R8433:Rnf6 UTSW 5 146211278 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCCGTTTGCTGTACTGGTC -3'
(R):5'- AGAAGCCAGACCTCCATGAG -3'

Sequencing Primer
(F):5'- GCTGTACTGGTCTACCCTGC -3'
(R):5'- ATGAGCTCCAGTGGTCCTAG -3'
Posted On2019-10-24