Incidental Mutation 'R7589:Klk10'
ID587308
Institutional Source Beutler Lab
Gene Symbol Klk10
Ensembl Gene ENSMUSG00000030693
Gene Namekallikrein related-peptidase 10
SynonymsNES1, PRSSL1, 2300002A13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43781035-43785410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43783627 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 149 (V149A)
Ref Sequence ENSEMBL: ENSMUSP00000014058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014058] [ENSMUST00000080211] [ENSMUST00000171458]
Predicted Effect probably benign
Transcript: ENSMUST00000014058
AA Change: V149A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000014058
Gene: ENSMUSG00000030693
AA Change: V149A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Tryp_SPc 46 271 1.35e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080211
SMART Domains Protein: ENSMUSP00000079101
Gene: ENSMUSG00000067616

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Tryp_SPc 47 269 5.14e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171458
SMART Domains Protein: ENSMUSP00000132721
Gene: ENSMUSG00000067616

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 20 242 5.14e-95 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its encoded protein is secreted and may play a role in suppression of tumorigenesis in breast and prostate cancers. Alternate splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Klk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Klk10 APN 7 43784976 missense probably damaging 1.00
IGL01657:Klk10 APN 7 43781589 missense possibly damaging 0.49
IGL02049:Klk10 APN 7 43784458 splice site probably benign
IGL02725:Klk10 APN 7 43781620 missense probably damaging 1.00
IGL03382:Klk10 APN 7 43784459 splice site probably benign
R0433:Klk10 UTSW 7 43781565 missense possibly damaging 0.51
R1521:Klk10 UTSW 7 43782880 missense probably benign 0.00
R1580:Klk10 UTSW 7 43782862 missense probably damaging 1.00
R4825:Klk10 UTSW 7 43783598 missense probably damaging 1.00
R5969:Klk10 UTSW 7 43784985 missense probably damaging 1.00
R6437:Klk10 UTSW 7 43782817 missense probably benign 0.04
R6641:Klk10 UTSW 7 43784900 missense possibly damaging 0.94
R7599:Klk10 UTSW 7 43784427 missense probably benign 0.03
R7902:Klk10 UTSW 7 43783518 missense probably benign 0.34
R7985:Klk10 UTSW 7 43783518 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TAGGGTTAGGCTCTGTCTCC -3'
(R):5'- TCCCTCAGATCTAGGGTCTAGC -3'

Sequencing Primer
(F):5'- AGGCTCTGTCTCCATGAAGG -3'
(R):5'- AGATCTAGGGTCTAGCTCTCACTCAG -3'
Posted On2019-10-24