Incidental Mutation 'R7589:Olfr635'
ID587309
Institutional Source Beutler Lab
Gene Symbol Olfr635
Ensembl Gene ENSMUSG00000094520
Gene Nameolfactory receptor 635
SynonymsGA_x6K02T2PBJ9-6713641-6714588, MOR5-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103971152-103987540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103979791 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 200 (Y200H)
Ref Sequence ENSEMBL: ENSMUSP00000148103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098185] [ENSMUST00000209473]
Predicted Effect probably damaging
Transcript: ENSMUST00000098185
AA Change: Y206H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095788
Gene: ENSMUSG00000094520
AA Change: Y206H

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 1.2e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 182 1.3e-9 PFAM
Pfam:7tm_1 49 300 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209473
AA Change: Y200H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Olfr635
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr635 APN 7 103979792 missense probably benign 0.09
IGL01330:Olfr635 APN 7 103980142 utr 3 prime probably benign
IGL01433:Olfr635 APN 7 103979332 missense probably damaging 1.00
FR4304:Olfr635 UTSW 7 103979903 frame shift probably null
FR4340:Olfr635 UTSW 7 103979903 frame shift probably null
FR4342:Olfr635 UTSW 7 103979903 frame shift probably null
R0271:Olfr635 UTSW 7 103979630 missense possibly damaging 0.83
R1909:Olfr635 UTSW 7 103979790 nonsense probably null
R2212:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R2484:Olfr635 UTSW 7 103979338 missense probably benign
R3412:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R4513:Olfr635 UTSW 7 103979441 missense probably benign 0.03
R4559:Olfr635 UTSW 7 103979560 missense probably damaging 1.00
R5032:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
R5436:Olfr635 UTSW 7 103979266 missense probably benign
R5591:Olfr635 UTSW 7 103980113 missense probably benign 0.00
R5617:Olfr635 UTSW 7 103979714 missense possibly damaging 0.91
R5911:Olfr635 UTSW 7 103979708 missense probably benign
R6249:Olfr635 UTSW 7 103979611 missense possibly damaging 0.85
R6275:Olfr635 UTSW 7 103979974 missense probably damaging 1.00
R6806:Olfr635 UTSW 7 103979564 missense possibly damaging 0.72
R8188:Olfr635 UTSW 7 103979536 missense probably damaging 1.00
R8337:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
RF004:Olfr635 UTSW 7 103979903 frame shift probably null
RF005:Olfr635 UTSW 7 103979561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTATGTGGCCATCTGTCGC -3'
(R):5'- AAGCGGTGAGTCATAGACAC -3'

Sequencing Primer
(F):5'- CCAGTGAGGTCATTGCTAGAATAG -3'
(R):5'- GTGAGTCATAGACACACCAACCATAG -3'
Posted On2019-10-24