Incidental Mutation 'R7589:Dglucy'
ID587316
Institutional Source Beutler Lab
Gene Symbol Dglucy
Ensembl Gene ENSMUSG00000021185
Gene NameD-glutamate cyclase
Synonyms9030617O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location100779057-100896981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100841401 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 160 (F160L)
Ref Sequence ENSEMBL: ENSMUSP00000067830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069782] [ENSMUST00000110069] [ENSMUST00000110070] [ENSMUST00000110073] [ENSMUST00000154603] [ENSMUST00000167322]
Predicted Effect probably damaging
Transcript: ENSMUST00000069782
AA Change: F160L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067830
Gene: ENSMUSG00000021185
AA Change: F160L

DomainStartEndE-ValueType
Pfam:DUF1445 115 257 1.1e-51 PFAM
Pfam:DUF4392 298 612 4.2e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110069
AA Change: F160L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105696
Gene: ENSMUSG00000021185
AA Change: F160L

DomainStartEndE-ValueType
Pfam:DUF1445 115 257 1.1e-51 PFAM
Pfam:DUF4392 298 612 4.2e-100 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110070
AA Change: F160L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105697
Gene: ENSMUSG00000021185
AA Change: F160L

DomainStartEndE-ValueType
Pfam:DUF1445 115 257 2.8e-51 PFAM
Pfam:DUF4392 298 563 2.5e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110073
AA Change: F190L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105700
Gene: ENSMUSG00000021185
AA Change: F190L

DomainStartEndE-ValueType
Pfam:DUF1445 145 287 7.2e-54 PFAM
Pfam:DUF4392 329 640 2.3e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154603
Predicted Effect probably damaging
Transcript: ENSMUST00000167322
AA Change: F160L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129876
Gene: ENSMUSG00000021185
AA Change: F160L

DomainStartEndE-ValueType
Pfam:DUF1445 115 257 1.1e-51 PFAM
Pfam:DUF4392 298 612 4.2e-100 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated D-glutamate levels in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Dglucy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Dglucy APN 12 100853217 missense probably damaging 1.00
IGL01885:Dglucy APN 12 100850281 missense probably damaging 0.97
IGL01911:Dglucy APN 12 100838525 missense probably damaging 0.96
IGL02240:Dglucy APN 12 100871413 missense possibly damaging 0.51
IGL02388:Dglucy APN 12 100856998 missense probably damaging 1.00
IGL02653:Dglucy APN 12 100871431 missense probably benign
IGL02829:Dglucy APN 12 100871404 missense probably damaging 1.00
R0096:Dglucy UTSW 12 100838651 missense possibly damaging 0.94
R0096:Dglucy UTSW 12 100838651 missense possibly damaging 0.94
R0591:Dglucy UTSW 12 100859518 splice site probably benign
R1723:Dglucy UTSW 12 100842679 missense probably damaging 1.00
R1765:Dglucy UTSW 12 100850102 splice site probably null
R1926:Dglucy UTSW 12 100867155 missense possibly damaging 0.94
R1968:Dglucy UTSW 12 100859644 missense possibly damaging 0.95
R2004:Dglucy UTSW 12 100856922 missense probably damaging 1.00
R3117:Dglucy UTSW 12 100838678 missense probably benign
R3716:Dglucy UTSW 12 100850116 missense probably damaging 0.97
R3946:Dglucy UTSW 12 100838700 critical splice donor site probably null
R3976:Dglucy UTSW 12 100841389 missense probably benign 0.01
R4782:Dglucy UTSW 12 100850343 missense probably benign 0.00
R4784:Dglucy UTSW 12 100838664 missense probably damaging 0.99
R4799:Dglucy UTSW 12 100850343 missense probably benign 0.00
R5037:Dglucy UTSW 12 100835241 missense probably benign 0.09
R5468:Dglucy UTSW 12 100850335 missense probably benign 0.01
R5609:Dglucy UTSW 12 100787646 missense probably null
R5994:Dglucy UTSW 12 100842700 missense probably benign 0.00
R6452:Dglucy UTSW 12 100835209 missense possibly damaging 0.93
R7257:Dglucy UTSW 12 100842738 missense probably damaging 1.00
R7488:Dglucy UTSW 12 100857051 missense possibly damaging 0.95
R7580:Dglucy UTSW 12 100850164 missense probably benign 0.29
R8383:Dglucy UTSW 12 100835329 missense probably benign 0.27
R8421:Dglucy UTSW 12 100842679 missense probably damaging 1.00
X0025:Dglucy UTSW 12 100838664 missense possibly damaging 0.84
X0061:Dglucy UTSW 12 100838598 missense probably benign 0.04
Z1176:Dglucy UTSW 12 100853304 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCCTGCACCCTAGTTTTGAG -3'
(R):5'- TGCTGCCTTAAGCCTGAGAG -3'

Sequencing Primer
(F):5'- GAGTCTCTCACTGTCAACCAGG -3'
(R):5'- CAGTACTGGACTTCTGGGTTTCAC -3'
Posted On2019-10-24