Incidental Mutation 'R7589:Rtl1'
ID587317
Institutional Source Beutler Lab
Gene Symbol Rtl1
Ensembl Gene ENSMUSG00000085925
Gene Nameretrotransposon Gaglike 1
SynonymsMart1, Mor1, Mar
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location109589193-109600330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109593845 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 520 (N520S)
Ref Sequence ENSEMBL: ENSMUSP00000115957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000149046
AA Change: N520S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115957
Gene: ENSMUSG00000085925
AA Change: N520S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 41 80 N/A INTRINSIC
internal_repeat_1 88 163 8.8e-50 PROSPERO
internal_repeat_1 176 251 8.8e-50 PROSPERO
low complexity region 332 361 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 393 408 N/A INTRINSIC
Pfam:DUF4939 432 538 1.6e-14 PFAM
Pfam:Retrotrans_gag 493 586 9.2e-13 PFAM
low complexity region 611 632 N/A INTRINSIC
Pfam:gag-asp_proteas 663 731 2.3e-15 PFAM
low complexity region 833 849 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
PDB:4OL8|E 988 1192 6e-17 PDB
Blast:CYCc 989 1158 5e-9 BLAST
SCOP:d1sig__ 1291 1443 2e-4 SMART
low complexity region 1733 1744 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice heterozygous for a paternally inherited knock-out allele exhibit fetal/neonatal lethality associated with underdevelopment of the placenta. Mice heteroygous for a maternally inherited knock-out allele exhibit neonatal lethality and decreased survival associated with placental overdevelopment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Rtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rtl1 APN 12 109593000 missense probably benign 0.00
IGL01981:Rtl1 APN 12 109591935 missense possibly damaging 0.72
IGL02418:Rtl1 APN 12 109590449 missense probably damaging 1.00
IGL03164:Rtl1 APN 12 109592933 missense probably damaging 1.00
FR4304:Rtl1 UTSW 12 109591198 small deletion probably benign
R0109:Rtl1 UTSW 12 109595407 start gained probably benign
R0141:Rtl1 UTSW 12 109592948 missense probably damaging 1.00
R0312:Rtl1 UTSW 12 109590227 missense probably damaging 0.99
R0389:Rtl1 UTSW 12 109590363 missense possibly damaging 0.77
R0390:Rtl1 UTSW 12 109591386 missense unknown
R0548:Rtl1 UTSW 12 109591655 missense probably damaging 0.98
R0561:Rtl1 UTSW 12 109593929 missense probably damaging 0.99
R0624:Rtl1 UTSW 12 109592719 missense probably damaging 0.97
R0746:Rtl1 UTSW 12 109592960 missense probably damaging 1.00
R1353:Rtl1 UTSW 12 109592199 missense probably benign 0.00
R1868:Rtl1 UTSW 12 109590536 missense probably damaging 1.00
R1935:Rtl1 UTSW 12 109591920 missense probably benign 0.42
R2000:Rtl1 UTSW 12 109593887 missense probably damaging 1.00
R2094:Rtl1 UTSW 12 109591397 missense unknown
R2125:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R2166:Rtl1 UTSW 12 109590554 missense probably damaging 1.00
R2247:Rtl1 UTSW 12 109594979 missense possibly damaging 0.77
R2274:Rtl1 UTSW 12 109594667 missense unknown
R2919:Rtl1 UTSW 12 109591148 missense unknown
R2998:Rtl1 UTSW 12 109595096 missense probably damaging 0.99
R4554:Rtl1 UTSW 12 109594328 missense possibly damaging 0.53
R4566:Rtl1 UTSW 12 109592859 missense probably damaging 1.00
R4887:Rtl1 UTSW 12 109591704 missense probably damaging 0.96
R5399:Rtl1 UTSW 12 109590302 missense probably damaging 1.00
R5512:Rtl1 UTSW 12 109591371 missense unknown
R5616:Rtl1 UTSW 12 109592739 missense unknown
R5644:Rtl1 UTSW 12 109591579 missense probably benign 0.03
R5647:Rtl1 UTSW 12 109594679 missense unknown
R5695:Rtl1 UTSW 12 109594097 missense probably damaging 1.00
R5714:Rtl1 UTSW 12 109593680 missense probably damaging 0.99
R5786:Rtl1 UTSW 12 109592619 missense possibly damaging 0.89
R5917:Rtl1 UTSW 12 109591653 missense possibly damaging 0.82
R5948:Rtl1 UTSW 12 109590599 missense possibly damaging 0.86
R6051:Rtl1 UTSW 12 109593024 missense probably damaging 1.00
R6251:Rtl1 UTSW 12 109593649 missense probably benign 0.16
R6342:Rtl1 UTSW 12 109592301 missense possibly damaging 0.50
R6433:Rtl1 UTSW 12 109595196 missense unknown
R6815:Rtl1 UTSW 12 109594503 missense probably damaging 0.98
R6968:Rtl1 UTSW 12 109594679 missense unknown
R7002:Rtl1 UTSW 12 109593947 missense probably damaging 0.97
R7020:Rtl1 UTSW 12 109592315 missense possibly damaging 0.72
R7026:Rtl1 UTSW 12 109593161 missense probably damaging 0.99
R7027:Rtl1 UTSW 12 109591414 small deletion probably benign
R7196:Rtl1 UTSW 12 109592787 missense possibly damaging 0.83
R7239:Rtl1 UTSW 12 109592475 missense probably benign 0.05
R7312:Rtl1 UTSW 12 109595238 missense unknown
R7476:Rtl1 UTSW 12 109591105 missense unknown
R7655:Rtl1 UTSW 12 109591008 missense unknown
R7656:Rtl1 UTSW 12 109591008 missense unknown
R7657:Rtl1 UTSW 12 109595384 missense possibly damaging 0.94
R7720:Rtl1 UTSW 12 109594430 missense possibly damaging 0.96
R7772:Rtl1 UTSW 12 109593185 missense probably damaging 1.00
R7840:Rtl1 UTSW 12 109594155 missense probably benign 0.08
R7890:Rtl1 UTSW 12 109592817 missense possibly damaging 0.57
R7893:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R7894:Rtl1 UTSW 12 109594597 missense possibly damaging 0.70
R7909:Rtl1 UTSW 12 109590177 missense unknown
R7909:Rtl1 UTSW 12 109592480 missense possibly damaging 0.95
R7986:Rtl1 UTSW 12 109592058 missense possibly damaging 0.95
R8007:Rtl1 UTSW 12 109591626 missense possibly damaging 0.86
R8146:Rtl1 UTSW 12 109590711 missense probably benign 0.01
R8193:Rtl1 UTSW 12 109592216 missense probably benign 0.03
R8263:Rtl1 UTSW 12 109593746 missense probably damaging 0.99
R8273:Rtl1 UTSW 12 109592715 missense possibly damaging 0.92
R8512:Rtl1 UTSW 12 109594617 missense unknown
R8514:Rtl1 UTSW 12 109593873 missense possibly damaging 0.52
Z1088:Rtl1 UTSW 12 109592319 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACAGATAGTGCCTGATCTCTTCG -3'
(R):5'- TCTCTGGAGATCGCAGAGAC -3'

Sequencing Primer
(F):5'- ATAGTGCCTGATCTCTTCGTTGAGC -3'
(R):5'- CGCAGAGACTACCATGAGTTTGTC -3'
Posted On2019-10-24