Incidental Mutation 'R7589:Zfp934'
ID587321
Institutional Source Beutler Lab
Gene Symbol Zfp934
Ensembl Gene ENSMUSG00000074865
Gene Namezinc finger protein 934
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location62479827-62571199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62518316 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 202 (N202K)
Ref Sequence ENSEMBL: ENSMUSP00000099083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076195] [ENSMUST00000082203] [ENSMUST00000101547] [ENSMUST00000220648] [ENSMUST00000221250] [ENSMUST00000222429] [ENSMUST00000222746] [ENSMUST00000222852]
Predicted Effect probably benign
Transcript: ENSMUST00000076195
SMART Domains Protein: ENSMUSP00000075552
Gene: ENSMUSG00000055228

DomainStartEndE-ValueType
KRAB 4 66 8.26e-16 SMART
ZnF_C2H2 133 155 2.09e-3 SMART
ZnF_C2H2 161 183 1.4e-4 SMART
ZnF_C2H2 189 211 2.57e-3 SMART
ZnF_C2H2 217 239 5.5e-3 SMART
ZnF_C2H2 245 267 7.26e-3 SMART
ZnF_C2H2 273 295 1.4e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082203
AA Change: N170K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080837
Gene: ENSMUSG00000074865
AA Change: N170K

DomainStartEndE-ValueType
Blast:KRAB 1 34 3e-16 BLAST
ZnF_C2H2 101 123 1.04e-3 SMART
ZnF_C2H2 129 149 1.68e1 SMART
ZnF_C2H2 157 179 2.75e-3 SMART
ZnF_C2H2 185 207 1.98e-4 SMART
ZnF_C2H2 213 235 3.21e-4 SMART
ZnF_C2H2 241 263 3.44e-4 SMART
ZnF_C2H2 269 292 4.98e-1 SMART
ZnF_C2H2 298 320 4.87e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000099083
Gene: ENSMUSG00000074865
AA Change: N202K

DomainStartEndE-ValueType
KRAB 3 65 5.01e-15 SMART
ZnF_C2H2 132 154 1.04e-3 SMART
ZnF_C2H2 160 180 1.68e1 SMART
ZnF_C2H2 188 210 2.75e-3 SMART
ZnF_C2H2 216 238 1.98e-4 SMART
ZnF_C2H2 244 266 3.21e-4 SMART
ZnF_C2H2 272 294 3.44e-4 SMART
ZnF_C2H2 300 322 2.27e-4 SMART
ZnF_C2H2 328 350 3.44e-4 SMART
ZnF_C2H2 356 378 9.22e-5 SMART
ZnF_C2H2 384 406 2.43e-4 SMART
ZnF_C2H2 412 434 1.3e-4 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220648
AA Change: N170K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000221250
Predicted Effect probably benign
Transcript: ENSMUST00000222429
Predicted Effect probably benign
Transcript: ENSMUST00000222746
Predicted Effect probably benign
Transcript: ENSMUST00000222852
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Other mutations in Zfp934
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1915:Zfp934 UTSW 13 62517955 missense probably damaging 1.00
R1957:Zfp934 UTSW 13 62518294 missense possibly damaging 0.83
R2113:Zfp934 UTSW 13 62518693 missense probably damaging 0.98
R2145:Zfp934 UTSW 13 62517834 missense probably damaging 1.00
R3732:Zfp934 UTSW 13 62517785 missense probably damaging 1.00
R3797:Zfp934 UTSW 13 62517888 missense probably benign
R4326:Zfp934 UTSW 13 62517559 missense probably benign 0.01
R4327:Zfp934 UTSW 13 62517559 missense probably benign 0.01
R4909:Zfp934 UTSW 13 62517954 missense probably damaging 1.00
R5236:Zfp934 UTSW 13 62517713 missense probably damaging 1.00
R5237:Zfp934 UTSW 13 62517838 missense probably damaging 1.00
R6305:Zfp934 UTSW 13 62518556 missense probably damaging 0.99
R6729:Zfp934 UTSW 13 62492932 missense probably damaging 1.00
R7072:Zfp934 UTSW 13 62520525 missense probably damaging 0.99
R7186:Zfp934 UTSW 13 62492390 missense probably benign 0.12
R7235:Zfp934 UTSW 13 62518150 missense
R7453:Zfp934 UTSW 13 62518703 missense probably benign 0.40
R7552:Zfp934 UTSW 13 62492891 missense probably damaging 1.00
R7624:Zfp934 UTSW 13 62518524 missense probably benign 0.27
R7651:Zfp934 UTSW 13 62518513 missense probably benign
R7780:Zfp934 UTSW 13 62518544 missense possibly damaging 0.92
R7857:Zfp934 UTSW 13 62517547 missense
R7891:Zfp934 UTSW 13 62520189 missense probably benign 0.35
R8130:Zfp934 UTSW 13 62520171 critical splice donor site probably null
R8298:Zfp934 UTSW 13 62518481 missense
Predicted Primers PCR Primer
(F):5'- TGGAGATGACATTTCTCAGAAAAGGT -3'
(R):5'- GGTAAAGCTTTCACATGTGCCA -3'

Sequencing Primer
(F):5'- tgtagggtttctctccaga -3'
(R):5'- GGATTTGCAAAGCCCAGTC -3'
Posted On2019-10-24