Incidental Mutation 'R7589:Atg14'
ID587324
Institutional Source Beutler Lab
Gene Symbol Atg14
Ensembl Gene ENSMUSG00000037526
Gene Nameautophagy related 14
SynonymsBarkor, D14Ertd436e, D14Ertd114e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location47540893-47570649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47543090 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 409 (D409G)
Ref Sequence ENSEMBL: ENSMUSP00000039047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042988] [ENSMUST00000226299]
Predicted Effect probably benign
Transcript: ENSMUST00000042988
AA Change: D409G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039047
Gene: ENSMUSG00000037526
AA Change: D409G

DomainStartEndE-ValueType
Pfam:Atg14 43 393 1.1e-79 PFAM
low complexity region 447 464 N/A INTRINSIC
low complexity region 465 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226299
AA Change: D409G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele following delivery of a Tat-cre exhibit increased mucin accumulation in colonic epithelial spheroids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Atg14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Atg14 APN 14 47542859 missense probably benign 0.00
IGL02513:Atg14 APN 14 47548994 missense probably benign 0.03
IGL02513:Atg14 APN 14 47545624 splice site probably benign
PIT4243001:Atg14 UTSW 14 47554574 missense possibly damaging 0.77
R1463:Atg14 UTSW 14 47548994 missense probably benign 0.03
R1479:Atg14 UTSW 14 47547239 critical splice donor site probably null
R1499:Atg14 UTSW 14 47560645 missense probably benign
R1781:Atg14 UTSW 14 47549150 critical splice acceptor site probably null
R1974:Atg14 UTSW 14 47545841 missense probably damaging 1.00
R2089:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2091:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2091:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2113:Atg14 UTSW 14 47551324 missense probably damaging 1.00
R4231:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4232:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4233:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4234:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4236:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4360:Atg14 UTSW 14 47568370 missense probably benign 0.00
R4711:Atg14 UTSW 14 47545841 missense probably damaging 1.00
R4883:Atg14 UTSW 14 47551314 missense probably damaging 1.00
R5025:Atg14 UTSW 14 47545816 missense probably damaging 1.00
R5235:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5250:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5297:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5301:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5338:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5450:Atg14 UTSW 14 47551464 missense probably benign
R5475:Atg14 UTSW 14 47568336 missense possibly damaging 0.83
R5799:Atg14 UTSW 14 47547295 missense possibly damaging 0.63
R6489:Atg14 UTSW 14 47549023 missense probably damaging 0.97
R7908:Atg14 UTSW 14 47568593 unclassified probably benign
Z1088:Atg14 UTSW 14 47568292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTCCAGTGTAAGCTTTGAAC -3'
(R):5'- AAATGCAGCAAGGTGAGTCTC -3'

Sequencing Primer
(F):5'- TCCAGTGTAAGCTTTGAACCAAGAG -3'
(R):5'- GCAGCAAGGTGAGTCTCTTTCC -3'
Posted On2019-10-24