Incidental Mutation 'R7589:Gsdmc2'
ID587326
Institutional Source Beutler Lab
Gene Symbol Gsdmc2
Ensembl Gene ENSMUSG00000056293
Gene Namegasdermin C2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location63824346-63845177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63825043 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 426 (L426F)
Ref Sequence ENSEMBL: ENSMUSP00000141066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089900] [ENSMUST00000188404] [ENSMUST00000188691]
Predicted Effect probably damaging
Transcript: ENSMUST00000089900
AA Change: L426F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087344
Gene: ENSMUSG00000056293
AA Change: L426F

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.8e-157 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188404
AA Change: L426F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141066
Gene: ENSMUSG00000056293
AA Change: L426F

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.7e-148 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188691
AA Change: L426F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140487
Gene: ENSMUSG00000056293
AA Change: L426F

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.7e-148 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Gsdmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Gsdmc2 APN 15 63828271 splice site probably benign
IGL02212:Gsdmc2 APN 15 63828062 splice site probably benign
IGL02394:Gsdmc2 APN 15 63835880 missense probably damaging 1.00
IGL02683:Gsdmc2 APN 15 63833412 missense probably damaging 1.00
R0046:Gsdmc2 UTSW 15 63827755 splice site probably benign
R0105:Gsdmc2 UTSW 15 63828177 missense probably benign
R0105:Gsdmc2 UTSW 15 63828177 missense probably benign
R0655:Gsdmc2 UTSW 15 63827773 missense probably benign 0.00
R1066:Gsdmc2 UTSW 15 63825050 missense possibly damaging 0.92
R1283:Gsdmc2 UTSW 15 63825057 missense probably damaging 0.99
R1691:Gsdmc2 UTSW 15 63833465 missense probably damaging 1.00
R1727:Gsdmc2 UTSW 15 63849779 unclassified probably benign
R1911:Gsdmc2 UTSW 15 63827772 missense probably benign 0.00
R1990:Gsdmc2 UTSW 15 63828237 missense probably benign 0.00
R1991:Gsdmc2 UTSW 15 63828237 missense probably benign 0.00
R2018:Gsdmc2 UTSW 15 63828126 splice site probably null
R2090:Gsdmc2 UTSW 15 63826826 missense probably benign 0.09
R3037:Gsdmc2 UTSW 15 63833331 missense probably benign 0.00
R3964:Gsdmc2 UTSW 15 63849834 unclassified probably benign
R4308:Gsdmc2 UTSW 15 63848705 unclassified probably benign
R4574:Gsdmc2 UTSW 15 63828023 critical splice donor site probably null
R4738:Gsdmc2 UTSW 15 63826801 nonsense probably null
R4873:Gsdmc2 UTSW 15 63828252 missense probably benign 0.41
R4875:Gsdmc2 UTSW 15 63828252 missense probably benign 0.41
R4883:Gsdmc2 UTSW 15 63835765 missense probably damaging 1.00
R5115:Gsdmc2 UTSW 15 63827768 missense probably benign 0.00
R5241:Gsdmc2 UTSW 15 63824894 missense probably benign 0.00
R5510:Gsdmc2 UTSW 15 63828196 missense probably benign
R5841:Gsdmc2 UTSW 15 63826210 missense probably benign 0.00
R5987:Gsdmc2 UTSW 15 63830866 missense probably benign 0.00
R6199:Gsdmc2 UTSW 15 63825113 missense probably benign 0.01
R6359:Gsdmc2 UTSW 15 63825017 missense probably damaging 1.00
R6610:Gsdmc2 UTSW 15 63825008 missense probably benign 0.03
R6984:Gsdmc2 UTSW 15 63825049 nonsense probably null
R7092:Gsdmc2 UTSW 15 63825098 missense probably damaging 0.99
R7204:Gsdmc2 UTSW 15 63825054 missense probably damaging 1.00
R7247:Gsdmc2 UTSW 15 63833334 missense probably benign 0.02
R7409:Gsdmc2 UTSW 15 63833346 missense possibly damaging 0.85
R7636:Gsdmc2 UTSW 15 63828192 missense probably benign 0.00
R7658:Gsdmc2 UTSW 15 63825054 missense probably damaging 1.00
R7673:Gsdmc2 UTSW 15 63825083 missense probably damaging 1.00
R8017:Gsdmc2 UTSW 15 63826913 missense probably benign 0.28
R8019:Gsdmc2 UTSW 15 63826913 missense probably benign 0.28
R8368:Gsdmc2 UTSW 15 63825053 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCCATAGCATCTTTATTCCC -3'
(R):5'- GGTGTTGGGACAGATCTTACC -3'

Sequencing Primer
(F):5'- CACTGGCCTAAAACATGCATGGTG -3'
(R):5'- TGGGACAGATCTTACCCTGGG -3'
Posted On2019-10-24