Incidental Mutation 'R7589:Enpp5'
ID587329
Institutional Source Beutler Lab
Gene Symbol Enpp5
Ensembl Gene ENSMUSG00000023960
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 5
SynonymsD17Abb1e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location44078813-44086567 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44085264 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 356 (G356S)
Ref Sequence ENSEMBL: ENSMUSP00000122767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]
Predicted Effect probably damaging
Transcript: ENSMUST00000024756
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 7.1e-91 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126032
Predicted Effect probably damaging
Transcript: ENSMUST00000154166
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 2.1e-86 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Meta Mutation Damage Score 0.9168 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Enpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Enpp5 APN 17 44085197 splice site probably benign
IGL01593:Enpp5 APN 17 44080721 missense probably benign
IGL01654:Enpp5 APN 17 44081175 missense possibly damaging 0.82
IGL02120:Enpp5 APN 17 44080845 missense probably benign 0.04
IGL02142:Enpp5 APN 17 44085577 missense probably benign 0.01
IGL02531:Enpp5 APN 17 44080952 missense probably damaging 1.00
IGL02630:Enpp5 APN 17 44082875 missense probably damaging 1.00
Cacao UTSW 17 44085576 missense probably benign 0.00
canola UTSW 17 44085264 missense probably damaging 1.00
R1101:Enpp5 UTSW 17 44081367 missense possibly damaging 0.77
R2074:Enpp5 UTSW 17 44085373 missense probably benign 0.25
R2679:Enpp5 UTSW 17 44085388 missense probably damaging 1.00
R4739:Enpp5 UTSW 17 44081136 missense probably damaging 1.00
R4817:Enpp5 UTSW 17 44080980 makesense probably null
R5152:Enpp5 UTSW 17 44081133 missense probably damaging 1.00
R6021:Enpp5 UTSW 17 44085319 missense probably benign 0.22
R6160:Enpp5 UTSW 17 44081368 missense possibly damaging 0.77
R6330:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6385:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6387:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6452:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6454:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6461:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6462:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6463:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6469:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6470:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6471:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6473:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6505:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6563:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6564:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6760:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6812:Enpp5 UTSW 17 44085576 missense probably benign 0.00
R6821:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6824:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6963:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6965:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7169:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7171:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7375:Enpp5 UTSW 17 44080977 missense probably benign 0.02
R7393:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7394:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7411:Enpp5 UTSW 17 44081475 missense probably damaging 1.00
R7412:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7446:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7447:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7560:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7561:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7590:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7591:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R8211:Enpp5 UTSW 17 44081511 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTGTAAGAAAGACGGGTATC -3'
(R):5'- ACTCTGTGTGTAAGGAATTGGC -3'

Sequencing Primer
(F):5'- GACGGGTATCTAGGTAACATTTGAC -3'
(R):5'- CTTGGGAGTTGCTGAACTGAGAAG -3'
Posted On2019-10-24