Incidental Mutation 'R7589:Cdc5l'
ID587330
Institutional Source Beutler Lab
Gene Symbol Cdc5l
Ensembl Gene ENSMUSG00000023932
Gene Namecell division cycle 5-like (S. pombe)
SynonymsPCDC5RP, 1200002I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location45391892-45433707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45410781 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 521 (R521Q)
Ref Sequence ENSEMBL: ENSMUSP00000024727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024727]
Predicted Effect probably benign
Transcript: ENSMUST00000024727
AA Change: R521Q

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024727
Gene: ENSMUSG00000023932
AA Change: R521Q

DomainStartEndE-ValueType
SANT 7 56 4.41e-15 SMART
SANT 59 106 6.29e-11 SMART
coiled coil region 150 181 N/A INTRINSIC
Blast:SANT 187 233 5e-23 BLAST
low complexity region 258 271 N/A INTRINSIC
Pfam:Myb_Cef 404 655 3.1e-85 PFAM
low complexity region 706 718 N/A INTRINSIC
coiled coil region 764 802 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Cdc5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Cdc5l APN 17 45404676 missense probably damaging 0.98
IGL01629:Cdc5l APN 17 45413190 missense probably benign 0.26
IGL02596:Cdc5l APN 17 45424604 splice site probably benign
IGL02973:Cdc5l APN 17 45404647 missense probably benign 0.31
IGL03102:Cdc5l APN 17 45407931 missense probably damaging 0.99
IGL03113:Cdc5l APN 17 45433422 missense possibly damaging 0.47
R0255:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0333:Cdc5l UTSW 17 45393216 splice site probably benign
R0432:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0532:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0551:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0839:Cdc5l UTSW 17 45393147 missense probably benign 0.10
R1462:Cdc5l UTSW 17 45408362 missense possibly damaging 0.77
R1462:Cdc5l UTSW 17 45408362 missense possibly damaging 0.77
R1483:Cdc5l UTSW 17 45408364 missense possibly damaging 0.79
R1634:Cdc5l UTSW 17 45404706 missense probably damaging 0.99
R1751:Cdc5l UTSW 17 45407805 missense probably benign
R1954:Cdc5l UTSW 17 45426516 splice site probably null
R1955:Cdc5l UTSW 17 45426516 splice site probably null
R2197:Cdc5l UTSW 17 45407819 missense probably benign 0.00
R2229:Cdc5l UTSW 17 45407846 missense probably benign 0.04
R4060:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4061:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4064:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4172:Cdc5l UTSW 17 45419772 missense probably damaging 1.00
R4334:Cdc5l UTSW 17 45410786 missense probably benign 0.00
R5093:Cdc5l UTSW 17 45393041 missense possibly damaging 0.50
R5268:Cdc5l UTSW 17 45415585 missense probably damaging 0.99
R5729:Cdc5l UTSW 17 45426569 missense probably benign 0.39
R6190:Cdc5l UTSW 17 45408017 missense probably benign 0.08
R6462:Cdc5l UTSW 17 45393049 missense probably benign
R6540:Cdc5l UTSW 17 45426644 missense probably damaging 1.00
R7232:Cdc5l UTSW 17 45427937 critical splice donor site probably null
R7381:Cdc5l UTSW 17 45411923 missense probably benign 0.00
R8120:Cdc5l UTSW 17 45407870 missense probably benign 0.00
R8424:Cdc5l UTSW 17 45415600 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TTGTCGGTCTGTACAGATCTAAG -3'
(R):5'- GGACCAATTCTTCTCTACAGGAAAG -3'

Sequencing Primer
(F):5'- ATGTTGTGGTGACCCCCAAC -3'
(R):5'- GAGAATCTCGTGAACATCTCCG -3'
Posted On2019-10-24