Mutagenetix > Incidental Mutations

Incidental Mutation 'R7589:Setbp1'

587333

Institutional Source

Beutler Lab

Gene Symbol

Setbp1

Ensembl Gene

ENSMUSG00000024548

Gene Name

SET binding protein 1

Synonyms

Seb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.699) question?

Stock #

R7589 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78750380-79109391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78856492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1320 (M1320K)

Ref Sequence

ENSEMBL: ENSMUSP00000025430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025430]

AlphaFold

Q9Z180

Predicted Effect

probably benign
Transcript: ENSMUST00000025430
AA Change: M1320K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: M1320K

Domain	Start	End	E-Value	Type
low complexity region	155	165	N/A	INTRINSIC
low complexity region	221	251	N/A	INTRINSIC
low complexity region	278	286	N/A	INTRINSIC
AT_hook	528	540	4.64e-1	SMART
low complexity region	565	571	N/A	INTRINSIC
low complexity region	594	617	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC
AT_hook	960	972	1.89e-1	SMART
low complexity region	1086	1103	N/A	INTRINSIC
low complexity region	1316	1337	N/A	INTRINSIC
AT_hook	1393	1405	7.27e-1	SMART
low complexity region	1462	1486	N/A	INTRINSIC
low complexity region	1498	1514	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	G	7: 41,626,972	C700G	probably damaging	Het
4930486L24Rik	T	C	13: 60,842,933	K316E	probably damaging	Het
Akap6	A	T	12: 53,142,063	K2087*	probably null	Het
Alpk2	A	T	18: 65,300,073	H1320Q	probably damaging	Het
Aox1	A	T	1: 58,041,484	R31W	probably damaging	Het
Asnsd1	G	T	1: 53,347,967	A167E	probably benign	Het
Atg14	T	C	14: 47,543,090	D409G	probably benign	Het
Atp13a3	T	A	16: 30,344,615	E574D	probably benign	Het
Bicd1	A	T	6: 149,513,667	Y626F	possibly damaging	Het
Cdc5l	C	T	17: 45,410,781	R521Q	probably benign	Het
Dglucy	T	C	12: 100,841,401	F160L	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fmo9	T	A	1: 166,674,428	K209N	possibly damaging	Het
Gsdmc2	C	A	15: 63,825,043	L426F	probably damaging	Het
Hip1	T	C	5: 135,414,311	D956G	probably benign	Het
Kif28	C	T	1: 179,731,400	V248I	probably benign	Het
Klk10	T	C	7: 43,783,627	V149A	probably benign	Het
Krt40	G	T	11: 99,540,157	N255K	probably damaging	Het
Map4k4	T	A	1: 40,021,091	Y1013*	probably null	Het
Mcur1	T	C	13: 43,551,625	Y185C	probably damaging	Het
Mzt1	T	C	14: 99,036,512		probably null	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Nkx1-2	T	C	7: 132,599,475	I18V	probably damaging	Het
Ofcc1	T	A	13: 40,255,484	Q155L	probably benign	Het
Olfr1239	A	G	2: 89,418,380	V11A	possibly damaging	Het
Olfr1282	T	C	2: 111,335,374	K235E	probably damaging	Het
Olfr1377	A	T	11: 50,985,030	M110L	probably damaging	Het
Olfr1411	G	A	1: 92,597,059	R180H	probably benign	Het
Olfr635	T	C	7: 103,979,791	Y200H	probably damaging	Het
Prnp	A	G	2: 131,936,866	D146G	probably benign	Het
Rhbdf1	C	T	11: 32,212,903	V455I	probably benign	Het
Rnf6	G	A	5: 146,211,429	R260W	possibly damaging	Het
Rtl1	T	C	12: 109,593,845	N520S	possibly damaging	Het
Slc39a8	A	G	3: 135,884,362	T338A	probably damaging	Het
Tcf4	A	G	18: 69,682,819	*693W	probably null	Het
Ttc8	A	T	12: 98,976,437	D412V	probably damaging	Het
Ush2a	G	T	1: 188,542,849	A1840S	probably benign	Het
Vmn1r60	A	T	7: 5,544,689	S137R		Het
Vmn1r91	T	A	7: 20,101,877	H240Q	probably benign	Het
Vmn2r107	A	T	17: 20,375,372	H729L	probably benign	Het
Yme1l1	C	T	2: 23,160,262	T35I	probably benign	Het
Zfp292	A	G	4: 34,806,777	V2094A	probably damaging	Het
Zfp934	A	T	13: 62,518,316	N202K		Het

Other mutations in Setbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Setbp1	APN	18	78755679	nonsense	probably null	0.00
IGL00668:Setbp1	APN	18	78857770	missense	probably damaging	1.00
IGL01628:Setbp1	APN	18	78856777	missense	probably damaging	1.00
IGL02084:Setbp1	APN	18	78857410	missense	probably damaging	1.00
IGL02405:Setbp1	APN	18	78857299	missense	probably damaging	1.00
IGL02427:Setbp1	APN	18	78857473	missense	probably damaging	1.00
IGL02612:Setbp1	APN	18	78755710	missense	probably damaging	1.00
IGL02725:Setbp1	APN	18	78857374	nonsense	probably null
IGL03005:Setbp1	APN	18	78859125	missense	possibly damaging	0.75
IGL03123:Setbp1	APN	18	78857009	missense	probably damaging	1.00
R1083:Setbp1	UTSW	18	78857626	missense	probably damaging	1.00
R1110:Setbp1	UTSW	18	78857860	missense	probably damaging	1.00
R1167:Setbp1	UTSW	18	78857236	missense	possibly damaging	0.85
R1221:Setbp1	UTSW	18	78856583	missense	probably damaging	1.00
R1225:Setbp1	UTSW	18	78858208	missense	probably damaging	0.99
R1327:Setbp1	UTSW	18	78783358	missense	probably benign	0.00
R1481:Setbp1	UTSW	18	78783301	missense	probably benign	0.01
R1482:Setbp1	UTSW	18	79086835	missense	probably damaging	1.00
R1496:Setbp1	UTSW	18	78859912	missense	probably damaging	1.00
R1550:Setbp1	UTSW	18	78858592	missense	probably damaging	1.00
R1708:Setbp1	UTSW	18	78858467	missense	probably damaging	0.99
R1751:Setbp1	UTSW	18	78857398	missense	probably damaging	1.00
R1922:Setbp1	UTSW	18	78858362	missense	possibly damaging	0.75
R1986:Setbp1	UTSW	18	78858544	missense	probably damaging	0.99
R2090:Setbp1	UTSW	18	78856720	missense	probably benign	0.00
R2851:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2853:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2941:Setbp1	UTSW	18	78858197	missense	probably damaging	1.00
R3151:Setbp1	UTSW	18	78857435	missense	probably damaging	1.00
R3156:Setbp1	UTSW	18	78859303	missense	probably benign	0.00
R3807:Setbp1	UTSW	18	78783322	missense	probably benign	0.01
R4133:Setbp1	UTSW	18	78856991	missense	probably benign	0.05
R4287:Setbp1	UTSW	18	78859061	missense	probably benign	0.03
R4345:Setbp1	UTSW	18	79086579	missense	probably damaging	0.99
R4374:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4377:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4378:Setbp1	UTSW	18	78856618	missense	possibly damaging	0.95
R4379:Setbp1	UTSW	18	79086681	missense	probably damaging	1.00
R4585:Setbp1	UTSW	18	79086949	missense	probably benign	0.00
R4595:Setbp1	UTSW	18	78857516	missense	probably benign	0.00
R4817:Setbp1	UTSW	18	78858800	missense	probably damaging	1.00
R4971:Setbp1	UTSW	18	78858167	missense	probably benign	0.07
R4976:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5017:Setbp1	UTSW	18	78856594	missense	possibly damaging	0.81
R5066:Setbp1	UTSW	18	78857299	missense	probably damaging	1.00
R5133:Setbp1	UTSW	18	78857482	missense	probably damaging	1.00
R5151:Setbp1	UTSW	18	78857999	missense	probably damaging	1.00
R5237:Setbp1	UTSW	18	78856975	missense	possibly damaging	0.92
R5480:Setbp1	UTSW	18	78858063	missense	probably damaging	0.99
R5507:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5529:Setbp1	UTSW	18	79086652	missense	probably damaging	0.99
R5622:Setbp1	UTSW	18	78857485	missense	probably damaging	1.00
R5722:Setbp1	UTSW	18	78856645	missense	possibly damaging	0.95
R5806:Setbp1	UTSW	18	78856482	splice site	probably null
R5940:Setbp1	UTSW	18	78755488	missense	probably damaging	1.00
R6025:Setbp1	UTSW	18	78859240	missense	probably damaging	0.98
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6250:Setbp1	UTSW	18	78858002	missense	probably benign	0.00
R6256:Setbp1	UTSW	18	78857257	missense	probably damaging	1.00
R6332:Setbp1	UTSW	18	78783369	missense	probably benign	0.21
R6522:Setbp1	UTSW	18	78857390	missense	probably damaging	0.98
R6873:Setbp1	UTSW	18	78859559	missense	probably benign	0.00
R6886:Setbp1	UTSW	18	78857500	missense	probably damaging	1.00
R6986:Setbp1	UTSW	18	78857839	missense	probably damaging	1.00
R7042:Setbp1	UTSW	18	79086855	missense	probably damaging	1.00
R7131:Setbp1	UTSW	18	79086960	missense	probably benign	0.08
R7134:Setbp1	UTSW	18	78859519	missense	possibly damaging	0.86
R7215:Setbp1	UTSW	18	78856837	missense	probably damaging	0.97
R7219:Setbp1	UTSW	18	78755745	missense	probably damaging	1.00
R7378:Setbp1	UTSW	18	78857486	missense	probably damaging	1.00
R7461:Setbp1	UTSW	18	78856492	missense	probably benign	0.06
R7840:Setbp1	UTSW	18	78783424	missense	probably benign	0.03
R7849:Setbp1	UTSW	18	78856853	missense	probably benign	0.00
R8147:Setbp1	UTSW	18	78856800	missense	probably damaging	1.00
R8354:Setbp1	UTSW	18	78857383	missense	probably damaging	1.00
R8446:Setbp1	UTSW	18	78857756	missense	probably damaging	1.00
R8524:Setbp1	UTSW	18	78858754	missense	probably damaging	1.00
R8534:Setbp1	UTSW	18	78783327	missense	possibly damaging	0.86
R8694:Setbp1	UTSW	18	78858301	missense	probably damaging	1.00
R8931:Setbp1	UTSW	18	78856508	missense	probably benign	0.00
R8983:Setbp1	UTSW	18	78859244	missense	probably benign	0.37
R9062:Setbp1	UTSW	18	78857051	missense	probably benign	0.01
R9113:Setbp1	UTSW	18	78857733	missense	probably damaging	0.99
R9364:Setbp1	UTSW	18	78783384	missense	probably benign	0.00
Z1088:Setbp1	UTSW	18	78859594	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGGCATTGGCTTTGTGGAAC -3'
(R):5'- AAAAGGTACTCTGGCAGCGG -3'

Sequencing Primer
(F):5'- CAGAAAGACAGGCAAATCATGTAAAC -3'
(R):5'- TACTCTGGCAGCGGTGGAG -3'

Posted On

2019-10-24