Incidental Mutation 'R7590:Lbr'
ID587336
Institutional Source Beutler Lab
Gene Symbol Lbr
Ensembl Gene ENSMUSG00000004880
Gene Namelamin B receptor
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_133815.2; Ensembl: ENSMUST00000005003

Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R7590 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location181815335-181843046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181821511 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 348 (S348P)
Ref Sequence ENSEMBL: ENSMUSP00000005003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005003]
Predicted Effect probably damaging
Transcript: ENSMUST00000005003
AA Change: S348P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005003
Gene: ENSMUSG00000004880
AA Change: S348P

DomainStartEndE-ValueType
TUDOR 4 62 6.7e-9 SMART
low complexity region 63 101 N/A INTRINSIC
low complexity region 111 121 N/A INTRINSIC
Pfam:ERG4_ERG24 194 626 4.6e-161 PFAM
Pfam:DUF1295 452 617 1.1e-9 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ERG4/ERG24 family. It localized in the nuclear envelope inner membrane and anchors the lamina and the heterochromatin to the membrane. It may mediate interaction between chromatin and lamin B. Mutations of this gene has been associated with autosomal recessive HEM/Greenberg skeletal dysplasia. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in abnormal skin and hair and impair growth. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(17) Spontaneous(6)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,515 T1373S probably damaging Het
Bbox1 A T 2: 110,268,232 N333K probably benign Het
Bcl11b T A 12: 108,003,143 M1L probably benign Het
C1s2 T A 6: 124,632,128 I157F probably damaging Het
Casp1 T A 9: 5,306,710 M384K probably damaging Het
Chpt1 A G 10: 88,480,826 S257P probably damaging Het
Dennd4a G A 9: 64,888,587 G731D probably benign Het
Dlk2 A T 17: 46,298,683 S21C probably benign Het
Ell2 T C 13: 75,770,735 L620P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fip1l1 T C 5: 74,591,774 V414A probably benign Het
Fmo1 T A 1: 162,859,682 probably benign Het
Fyb2 A G 4: 104,945,246 N115S probably benign Het
Gdi2 A G 13: 3,564,611 T319A probably benign Het
Gm10471 G T 5: 26,085,766 H136N possibly damaging Het
Hecw1 A G 13: 14,264,083 V905A probably damaging Het
Ireb2 T A 9: 54,896,495 V490D probably benign Het
Loxhd1 T A 18: 77,321,634 D191E possibly damaging Het
Mlip A T 9: 77,230,043 D527E probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5 G T 1: 126,026,533 Q761K probably benign Het
Neb A T 2: 52,243,842 D3376E probably damaging Het
Nek10 A G 14: 15,006,693 *1116W probably null Het
Olfr224 T C 11: 58,567,259 I29V probably benign Het
Olfr491 A T 7: 108,317,179 H95L probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
Pak2 A T 16: 32,052,196 I56K probably benign Het
Pgm5 T C 19: 24,709,265 Y526C probably damaging Het
Phc2 T A 4: 128,748,027 L714H probably damaging Het
Phf13 A T 4: 151,991,775 D223E probably damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rbm6 A T 9: 107,791,750 probably null Het
Scn10a A G 9: 119,666,400 M352T probably damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Slc13a4 T A 6: 35,279,463 I321F possibly damaging Het
Spata9 T C 13: 75,977,652 S85P possibly damaging Het
Ssb G A 2: 69,867,290 A122T probably benign Het
Ssfa2 G T 2: 79,658,110 V846F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Ten1 T C 11: 116,205,640 L40P possibly damaging Het
Tex10 A C 4: 48,467,725 V358G probably damaging Het
Tmprss11c A T 5: 86,239,473 H195Q probably benign Het
Tor4a A G 2: 25,195,798 V31A possibly damaging Het
Trim29 G A 9: 43,311,491 A206T probably damaging Het
Trim71 A C 9: 114,562,825 V98G probably benign Het
Trpm6 C G 19: 18,832,581 L1114V probably benign Het
Usp1 A G 4: 98,934,252 D601G possibly damaging Het
Vmn2r18 T A 5: 151,561,729 I767F probably damaging Het
Other mutations in Lbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Lbr APN 1 181825643 nonsense probably null
IGL01680:Lbr APN 1 181836194 missense probably damaging 1.00
IGL02738:Lbr APN 1 181832213 missense probably benign 0.16
IGL03048:Lbr APN 1 181838544 utr 5 prime probably benign
IGL03227:Lbr APN 1 181836055 unclassified probably null
IGL03337:Lbr APN 1 181832223 missense possibly damaging 0.92
Aconcagua UTSW 1 181828902 missense probably benign 0.02
kosciuszko UTSW 1 181825621 critical splice donor site probably null
Mont_blanc UTSW 1 181820702 missense probably damaging 1.00
seven UTSW 1 181832213 missense probably benign 0.16
1mM(1):Lbr UTSW 1 181831679 missense possibly damaging 0.65
H8562:Lbr UTSW 1 181820668 splice site probably benign
IGL02991:Lbr UTSW 1 181821552 missense probably damaging 1.00
R0597:Lbr UTSW 1 181832213 missense probably benign 0.16
R1118:Lbr UTSW 1 181820668 splice site probably benign
R1727:Lbr UTSW 1 181819916 missense probably benign 0.01
R2566:Lbr UTSW 1 181836127 missense probably damaging 0.96
R3699:Lbr UTSW 1 181818920 missense probably damaging 1.00
R3854:Lbr UTSW 1 181831715 missense probably benign 0.05
R4290:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4292:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4293:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4294:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4295:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4771:Lbr UTSW 1 181838421 missense probably damaging 1.00
R4890:Lbr UTSW 1 181817568 missense probably benign 0.10
R5011:Lbr UTSW 1 181819888 nonsense probably null
R5402:Lbr UTSW 1 181819961 missense probably benign 0.00
R5486:Lbr UTSW 1 181818838 critical splice donor site probably null
R5617:Lbr UTSW 1 181828902 missense probably benign 0.02
R5630:Lbr UTSW 1 181816964 unclassified probably null
R6360:Lbr UTSW 1 181832155 missense probably benign 0.00
R6575:Lbr UTSW 1 181836198 missense probably damaging 1.00
R7069:Lbr UTSW 1 181828789 missense probably damaging 1.00
R7342:Lbr UTSW 1 181825621 critical splice donor site probably null
R7686:Lbr UTSW 1 181817521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTGAAGGATTTTAGTCACATAC -3'
(R):5'- ATGTAGCCCCAGGATGAGTGAC -3'

Sequencing Primer
(F):5'- TGAGAACTAAATAGAAAAGCATGAGG -3'
(R):5'- CCCCAGGATGAGTGACGTTAATTAAC -3'
Posted On2019-10-24