Incidental Mutation 'R7590:Phf13'
ID587347
Institutional Source Beutler Lab
Gene Symbol Phf13
Ensembl Gene ENSMUSG00000047777
Gene NamePHD finger protein 13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7590 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location151989633-151996258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151991775 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 223 (D223E)
Ref Sequence ENSEMBL: ENSMUSP00000062590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036680] [ENSMUST00000055688] [ENSMUST00000105665]
Predicted Effect probably benign
Transcript: ENSMUST00000036680
SMART Domains Protein: ENSMUSP00000035240
Gene: ENSMUSG00000039759

DomainStartEndE-ValueType
THAP 3 88 5.28e-19 SMART
DM3 23 87 6.96e-21 SMART
coiled coil region 166 189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000055688
AA Change: D223E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062590
Gene: ENSMUSG00000047777
AA Change: D223E

DomainStartEndE-ValueType
low complexity region 103 122 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
PHD 230 274 4.35e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105665
SMART Domains Protein: ENSMUSP00000101290
Gene: ENSMUSG00000039759

DomainStartEndE-ValueType
THAP 3 88 5.28e-19 SMART
DM3 23 87 6.96e-21 SMART
coiled coil region 132 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced male fertility over time associated with impaired spermatogonial stem cell differentiation and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,515 T1373S probably damaging Het
Bbox1 A T 2: 110,268,232 N333K probably benign Het
Bcl11b T A 12: 108,003,143 M1L probably benign Het
C1s2 T A 6: 124,632,128 I157F probably damaging Het
Casp1 T A 9: 5,306,710 M384K probably damaging Het
Chpt1 A G 10: 88,480,826 S257P probably damaging Het
Dennd4a G A 9: 64,888,587 G731D probably benign Het
Dlk2 A T 17: 46,298,683 S21C probably benign Het
Ell2 T C 13: 75,770,735 L620P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fip1l1 T C 5: 74,591,774 V414A probably benign Het
Fmo1 T A 1: 162,859,682 probably benign Het
Fyb2 A G 4: 104,945,246 N115S probably benign Het
Gdi2 A G 13: 3,564,611 T319A probably benign Het
Gm10471 G T 5: 26,085,766 H136N possibly damaging Het
Hecw1 A G 13: 14,264,083 V905A probably damaging Het
Ireb2 T A 9: 54,896,495 V490D probably benign Het
Lbr A G 1: 181,821,511 S348P probably damaging Het
Loxhd1 T A 18: 77,321,634 D191E possibly damaging Het
Mlip A T 9: 77,230,043 D527E probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5 G T 1: 126,026,533 Q761K probably benign Het
Neb A T 2: 52,243,842 D3376E probably damaging Het
Nek10 A G 14: 15,006,693 *1116W probably null Het
Olfr224 T C 11: 58,567,259 I29V probably benign Het
Olfr491 A T 7: 108,317,179 H95L probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
Pak2 A T 16: 32,052,196 I56K probably benign Het
Pgm5 T C 19: 24,709,265 Y526C probably damaging Het
Phc2 T A 4: 128,748,027 L714H probably damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rbm6 A T 9: 107,791,750 probably null Het
Scn10a A G 9: 119,666,400 M352T probably damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Slc13a4 T A 6: 35,279,463 I321F possibly damaging Het
Spata9 T C 13: 75,977,652 S85P possibly damaging Het
Ssb G A 2: 69,867,290 A122T probably benign Het
Ssfa2 G T 2: 79,658,110 V846F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Ten1 T C 11: 116,205,640 L40P possibly damaging Het
Tex10 A C 4: 48,467,725 V358G probably damaging Het
Tmprss11c A T 5: 86,239,473 H195Q probably benign Het
Tor4a A G 2: 25,195,798 V31A possibly damaging Het
Trim29 G A 9: 43,311,491 A206T probably damaging Het
Trim71 A C 9: 114,562,825 V98G probably benign Het
Trpm6 C G 19: 18,832,581 L1114V probably benign Het
Usp1 A G 4: 98,934,252 D601G possibly damaging Het
Vmn2r18 T A 5: 151,561,729 I767F probably damaging Het
Other mutations in Phf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Phf13 APN 4 151995828 missense probably benign
IGL03288:Phf13 APN 4 151992369 missense possibly damaging 0.74
R0685:Phf13 UTSW 4 151991612 missense probably damaging 0.96
R1660:Phf13 UTSW 4 151992505 missense probably benign
R3052:Phf13 UTSW 4 151992363 missense possibly damaging 0.53
R4249:Phf13 UTSW 4 151992095 missense probably damaging 1.00
R5232:Phf13 UTSW 4 151992223 missense probably damaging 0.99
R6619:Phf13 UTSW 4 151991657 missense probably damaging 1.00
R6801:Phf13 UTSW 4 151991560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCAGAAACAGCTTCCG -3'
(R):5'- TTGTTAGCTCCTGGAGACTGC -3'

Sequencing Primer
(F):5'- TTGGAGCGACGGATATCAAACTTG -3'
(R):5'- AGACTGCCAGGTTGCTCTG -3'
Posted On2019-10-24