Incidental Mutation 'R7590:Fip1l1'
ID587349
Institutional Source Beutler Lab
Gene Symbol Fip1l1
Ensembl Gene ENSMUSG00000029227
Gene NameFIP1 like 1 (S. cerevisiae)
Synonyms1300019H17Rik, Rje
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R7590 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location74535449-74598800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74591774 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 414 (V414A)
Ref Sequence ENSEMBL: ENSMUSP00000109164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039744] [ENSMUST00000080164] [ENSMUST00000087161] [ENSMUST00000113531] [ENSMUST00000113534] [ENSMUST00000113535] [ENSMUST00000113536] [ENSMUST00000120618] [ENSMUST00000127396]
Predicted Effect probably benign
Transcript: ENSMUST00000039744
SMART Domains Protein: ENSMUSP00000040098
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000080164
AA Change: V378A

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079059
Gene: ENSMUSG00000029227
AA Change: V378A

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.2e-28 PFAM
low complexity region 296 357 N/A INTRINSIC
low complexity region 405 441 N/A INTRINSIC
low complexity region 453 507 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087161
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113531
SMART Domains Protein: ENSMUSP00000109159
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
Blast:PDZ 2 105 2e-32 BLAST
PDZ 129 204 5.33e-19 SMART
PDZ 236 309 2.27e-13 SMART
PDZ 358 435 8.27e-16 SMART
PDZ 488 565 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113534
AA Change: V428A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109162
Gene: ENSMUSG00000029227
AA Change: V428A

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.1e-28 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113535
AA Change: V369A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109163
Gene: ENSMUSG00000029227
AA Change: V369A

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 6.4e-29 PFAM
low complexity region 296 346 N/A INTRINSIC
low complexity region 396 432 N/A INTRINSIC
low complexity region 444 498 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113536
AA Change: V414A

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109164
Gene: ENSMUSG00000029227
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.3e-28 PFAM
low complexity region 247 267 N/A INTRINSIC
low complexity region 332 393 N/A INTRINSIC
low complexity region 441 477 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
low complexity region 546 559 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120618
AA Change: V422A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113995
Gene: ENSMUSG00000029227
AA Change: V422A

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Pfam:Fip1 137 181 2e-29 PFAM
low complexity region 255 275 N/A INTRINSIC
low complexity region 340 401 N/A INTRINSIC
low complexity region 449 485 N/A INTRINSIC
low complexity region 497 551 N/A INTRINSIC
low complexity region 554 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127396
SMART Domains Protein: ENSMUSP00000120886
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,515 T1373S probably damaging Het
Bbox1 A T 2: 110,268,232 N333K probably benign Het
Bcl11b T A 12: 108,003,143 M1L probably benign Het
C1s2 T A 6: 124,632,128 I157F probably damaging Het
Casp1 T A 9: 5,306,710 M384K probably damaging Het
Chpt1 A G 10: 88,480,826 S257P probably damaging Het
Dennd4a G A 9: 64,888,587 G731D probably benign Het
Dlk2 A T 17: 46,298,683 S21C probably benign Het
Ell2 T C 13: 75,770,735 L620P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo1 T A 1: 162,859,682 probably benign Het
Fyb2 A G 4: 104,945,246 N115S probably benign Het
Gdi2 A G 13: 3,564,611 T319A probably benign Het
Gm10471 G T 5: 26,085,766 H136N possibly damaging Het
Hecw1 A G 13: 14,264,083 V905A probably damaging Het
Ireb2 T A 9: 54,896,495 V490D probably benign Het
Lbr A G 1: 181,821,511 S348P probably damaging Het
Loxhd1 T A 18: 77,321,634 D191E possibly damaging Het
Mlip A T 9: 77,230,043 D527E probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5 G T 1: 126,026,533 Q761K probably benign Het
Neb A T 2: 52,243,842 D3376E probably damaging Het
Nek10 A G 14: 15,006,693 *1116W probably null Het
Olfr224 T C 11: 58,567,259 I29V probably benign Het
Olfr491 A T 7: 108,317,179 H95L probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
Pak2 A T 16: 32,052,196 I56K probably benign Het
Pgm5 T C 19: 24,709,265 Y526C probably damaging Het
Phc2 T A 4: 128,748,027 L714H probably damaging Het
Phf13 A T 4: 151,991,775 D223E probably damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rbm6 A T 9: 107,791,750 probably null Het
Scn10a A G 9: 119,666,400 M352T probably damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Slc13a4 T A 6: 35,279,463 I321F possibly damaging Het
Spata9 T C 13: 75,977,652 S85P possibly damaging Het
Ssb G A 2: 69,867,290 A122T probably benign Het
Ssfa2 G T 2: 79,658,110 V846F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Ten1 T C 11: 116,205,640 L40P possibly damaging Het
Tex10 A C 4: 48,467,725 V358G probably damaging Het
Tmprss11c A T 5: 86,239,473 H195Q probably benign Het
Tor4a A G 2: 25,195,798 V31A possibly damaging Het
Trim29 G A 9: 43,311,491 A206T probably damaging Het
Trim71 A C 9: 114,562,825 V98G probably benign Het
Trpm6 C G 19: 18,832,581 L1114V probably benign Het
Usp1 A G 4: 98,934,252 D601G possibly damaging Het
Vmn2r18 T A 5: 151,561,729 I767F probably damaging Het
Other mutations in Fip1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Fip1l1 APN 5 74587065 splice site probably benign
IGL02008:Fip1l1 APN 5 74545423 missense possibly damaging 0.80
IGL02069:Fip1l1 APN 5 74591873 missense probably damaging 1.00
IGL02406:Fip1l1 APN 5 74564544 missense probably benign 0.01
IGL02514:Fip1l1 APN 5 74571152 missense probably damaging 1.00
IGL03139:Fip1l1 APN 5 74571115 missense possibly damaging 0.84
R0031:Fip1l1 UTSW 5 74557109 missense probably damaging 1.00
R0325:Fip1l1 UTSW 5 74595842 missense probably damaging 1.00
R0600:Fip1l1 UTSW 5 74595842 missense probably damaging 1.00
R0834:Fip1l1 UTSW 5 74595060 unclassified probably benign
R1183:Fip1l1 UTSW 5 74595102 missense probably damaging 1.00
R1328:Fip1l1 UTSW 5 74546135 missense possibly damaging 0.94
R2434:Fip1l1 UTSW 5 74546824 missense possibly damaging 0.81
R4120:Fip1l1 UTSW 5 74588191 missense probably damaging 1.00
R4197:Fip1l1 UTSW 5 74535736 missense probably damaging 1.00
R4440:Fip1l1 UTSW 5 74536785 intron probably benign
R4825:Fip1l1 UTSW 5 74588205 splice site probably null
R4838:Fip1l1 UTSW 5 74591939 missense probably damaging 1.00
R5800:Fip1l1 UTSW 5 74546081 missense possibly damaging 0.77
R6159:Fip1l1 UTSW 5 74591947 missense probably damaging 1.00
R6556:Fip1l1 UTSW 5 74547177 critical splice donor site probably null
R6724:Fip1l1 UTSW 5 74591774 missense probably damaging 0.99
R6984:Fip1l1 UTSW 5 74542073 missense probably damaging 0.99
R7092:Fip1l1 UTSW 5 74536843 missense probably damaging 0.98
R7205:Fip1l1 UTSW 5 74588075 intron probably null
R7325:Fip1l1 UTSW 5 74536799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAGGTGTTTTATATCATGTAGTC -3'
(R):5'- TGAACTGGAATTCATCTCCTCACATC -3'

Sequencing Primer
(F):5'- ACACATACACGGGTGCTTTG -3'
(R):5'- CCTGTTGAAAACACTTGGGG -3'
Posted On2019-10-24