Incidental Mutation 'R7590:Tmprss11c'
ID587350
Institutional Source Beutler Lab
Gene Symbol Tmprss11c
Ensembl Gene ENSMUSG00000061184
Gene Nametransmembrane protease, serine 11c
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7590 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location86231481-86289308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86239473 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 195 (H195Q)
Ref Sequence ENSEMBL: ENSMUSP00000062915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059424] [ENSMUST00000196462]
Predicted Effect probably benign
Transcript: ENSMUST00000059424
AA Change: H195Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000062915
Gene: ENSMUSG00000061184
AA Change: H195Q

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 183 5.19e-3 SMART
Tryp_SPc 199 425 8.42e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196462
AA Change: H182Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142902
Gene: ENSMUSG00000061184
AA Change: H182Q

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 176 3.6e-4 SMART
Tryp_SPc 186 412 4.1e-93 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,515 T1373S probably damaging Het
Bbox1 A T 2: 110,268,232 N333K probably benign Het
Bcl11b T A 12: 108,003,143 M1L probably benign Het
C1s2 T A 6: 124,632,128 I157F probably damaging Het
Casp1 T A 9: 5,306,710 M384K probably damaging Het
Chpt1 A G 10: 88,480,826 S257P probably damaging Het
Dennd4a G A 9: 64,888,587 G731D probably benign Het
Dlk2 A T 17: 46,298,683 S21C probably benign Het
Ell2 T C 13: 75,770,735 L620P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fip1l1 T C 5: 74,591,774 V414A probably benign Het
Fmo1 T A 1: 162,859,682 probably benign Het
Fyb2 A G 4: 104,945,246 N115S probably benign Het
Gdi2 A G 13: 3,564,611 T319A probably benign Het
Gm10471 G T 5: 26,085,766 H136N possibly damaging Het
Hecw1 A G 13: 14,264,083 V905A probably damaging Het
Ireb2 T A 9: 54,896,495 V490D probably benign Het
Lbr A G 1: 181,821,511 S348P probably damaging Het
Loxhd1 T A 18: 77,321,634 D191E possibly damaging Het
Mlip A T 9: 77,230,043 D527E probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5 G T 1: 126,026,533 Q761K probably benign Het
Neb A T 2: 52,243,842 D3376E probably damaging Het
Nek10 A G 14: 15,006,693 *1116W probably null Het
Olfr224 T C 11: 58,567,259 I29V probably benign Het
Olfr491 A T 7: 108,317,179 H95L probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
Pak2 A T 16: 32,052,196 I56K probably benign Het
Pgm5 T C 19: 24,709,265 Y526C probably damaging Het
Phc2 T A 4: 128,748,027 L714H probably damaging Het
Phf13 A T 4: 151,991,775 D223E probably damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rbm6 A T 9: 107,791,750 probably null Het
Scn10a A G 9: 119,666,400 M352T probably damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Slc13a4 T A 6: 35,279,463 I321F possibly damaging Het
Spata9 T C 13: 75,977,652 S85P possibly damaging Het
Ssb G A 2: 69,867,290 A122T probably benign Het
Ssfa2 G T 2: 79,658,110 V846F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Ten1 T C 11: 116,205,640 L40P possibly damaging Het
Tex10 A C 4: 48,467,725 V358G probably damaging Het
Tor4a A G 2: 25,195,798 V31A possibly damaging Het
Trim29 G A 9: 43,311,491 A206T probably damaging Het
Trim71 A C 9: 114,562,825 V98G probably benign Het
Trpm6 C G 19: 18,832,581 L1114V probably benign Het
Usp1 A G 4: 98,934,252 D601G possibly damaging Het
Vmn2r18 T A 5: 151,561,729 I767F probably damaging Het
Other mutations in Tmprss11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmprss11c APN 5 86239395 missense probably benign 0.00
IGL01357:Tmprss11c APN 5 86231807 missense probably damaging 1.00
IGL01809:Tmprss11c APN 5 86237662 missense possibly damaging 0.89
IGL02972:Tmprss11c APN 5 86237833 missense possibly damaging 0.77
IGL03135:Tmprss11c APN 5 86237650 missense probably damaging 1.00
IGL03255:Tmprss11c APN 5 86271482 missense probably damaging 0.99
IGL03355:Tmprss11c APN 5 86231871 missense probably benign 0.03
R0165:Tmprss11c UTSW 5 86231927 splice site probably benign
R0285:Tmprss11c UTSW 5 86271430 missense probably damaging 1.00
R0480:Tmprss11c UTSW 5 86237609 splice site probably benign
R0639:Tmprss11c UTSW 5 86235469 missense probably damaging 1.00
R1554:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R1651:Tmprss11c UTSW 5 86239424 missense probably damaging 1.00
R2234:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2235:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2698:Tmprss11c UTSW 5 86271463 missense probably damaging 1.00
R4787:Tmprss11c UTSW 5 86256453 missense probably benign 0.00
R4962:Tmprss11c UTSW 5 86237710 missense probably damaging 1.00
R5063:Tmprss11c UTSW 5 86237830 missense probably benign 0.28
R5217:Tmprss11c UTSW 5 86256390 missense probably benign
R5366:Tmprss11c UTSW 5 86282134 missense possibly damaging 0.93
R6343:Tmprss11c UTSW 5 86256345 missense probably damaging 1.00
R6598:Tmprss11c UTSW 5 86289233 missense probably benign 0.01
R6681:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R7170:Tmprss11c UTSW 5 86237619 critical splice donor site probably null
R7198:Tmprss11c UTSW 5 86231832 missense probably damaging 1.00
R7258:Tmprss11c UTSW 5 86271413 missense probably damaging 1.00
R7382:Tmprss11c UTSW 5 86231864 missense probably benign 0.19
R7391:Tmprss11c UTSW 5 86237791 missense probably damaging 1.00
R7894:Tmprss11c UTSW 5 86231796 missense probably damaging 1.00
R7977:Tmprss11c UTSW 5 86231796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTGCCCTTGAGACCTTC -3'
(R):5'- GACTAAGATGGCAACGTATTTGG -3'

Sequencing Primer
(F):5'- CCCAGGTCTTAGCTCACCGTATG -3'
(R):5'- CTTCAGGAAATCATGTCAGCAG -3'
Posted On2019-10-24