Mutagenetix > Incidental Mutation

Incidental Mutation 'R0622:Pou2f3'

58736

Institutional Source

Beutler Lab

Gene Symbol

Pou2f3

Ensembl Gene

ENSMUSG00000032015

Gene Name

POU domain, class 2, transcription factor 3

Synonyms

Otf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11

MMRRC Submission

038811-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0622 (G1)

Quality Score

184

Status

Not validated

Chromosome

Chromosomal Location

43123939-43210369 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43125119 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 423 (R423H)

Ref Sequence

ENSEMBL: ENSMUSP00000135115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034513
AA Change: R411H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: R411H

Domain	Start	End	E-Value	Type
low complexity region	107	122	N/A	INTRINSIC
low complexity region	150	162	N/A	INTRINSIC
POU	164	238	1.47e-53	SMART
low complexity region	239	256	N/A	INTRINSIC
HOX	262	324	8.39e-20	SMART
low complexity region	337	352	N/A	INTRINSIC
low complexity region	362	378	N/A	INTRINSIC
low complexity region	386	408	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176636
AA Change: R423H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: R423H

Domain	Start	End	E-Value	Type
low complexity region	119	134	N/A	INTRINSIC
low complexity region	162	174	N/A	INTRINSIC
POU	176	250	1.47e-53	SMART
low complexity region	251	268	N/A	INTRINSIC
HOX	274	336	8.39e-20	SMART
low complexity region	349	364	N/A	INTRINSIC
low complexity region	374	390	N/A	INTRINSIC
low complexity region	398	420	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213862

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtr1a	T	A	13: 30,381,681	M243K	probably benign	Het
Ap1b1	A	G	11: 5,037,707	M744V	probably damaging	Het
C87977	T	C	4: 144,213,013		probably benign	Het
Ccdc152	T	C	15: 3,298,178	N39S	probably damaging	Het
Cd163	G	A	6: 124,317,352	V490M	probably damaging	Het
Col6a5	G	T	9: 105,925,852	H1305N	unknown	Het
Cpb1	C	A	3: 20,249,818	D361Y	probably damaging	Het
Dchs1	T	A	7: 105,763,449	Y1248F	probably damaging	Het
Dhdds	G	C	4: 133,994,236	F83L	probably damaging	Het
Dsg4	T	A	18: 20,449,788	V161E	possibly damaging	Het
Exosc4	A	G	15: 76,327,536	D15G	probably damaging	Het
F3	A	T	3: 121,725,019	D44V	probably damaging	Het
Fat2	A	T	11: 55,283,128	F2253Y	probably damaging	Het
Fbn1	T	C	2: 125,379,024	D650G	possibly damaging	Het
Gramd4	T	A	15: 86,091,389	F36I	probably damaging	Het
Grm7	G	A	6: 111,358,496	A623T	probably damaging	Het
Gys1	A	T	7: 45,439,995	T193S	probably damaging	Het
Hectd4	A	G	5: 121,348,625	T3228A	possibly damaging	Het
Itpk1	G	T	12: 102,573,980	D281E	probably damaging	Het
Kcnh7	A	C	2: 62,837,289		probably null	Het
Klhl29	A	G	12: 5,081,224	L852P	probably damaging	Het
Lrch1	T	C	14: 74,796,051	Y509C	probably benign	Het
Lrp1b	A	G	2: 41,728,551		probably null	Het
Mcpt4	C	A	14: 56,060,662	R144L	probably benign	Het
Mia2	C	T	12: 59,131,578	R12W	probably damaging	Het
Mrps5	A	G	2: 127,594,531	K116R	probably benign	Het
Myrf	G	A	19: 10,223,452	P286S	probably damaging	Het
Nanp	A	G	2: 151,039,244	M28T	probably benign	Het
Neb	T	C	2: 52,212,951	I4472V	probably benign	Het
Nfix	A	C	8: 84,726,482	N314K	probably damaging	Het
Nlrc3	C	T	16: 3,953,968	R849Q	probably benign	Het
Nup210l	G	A	3: 90,167,740	V786M	probably damaging	Het
Olfr1346	T	C	7: 6,474,599	I163T	possibly damaging	Het
Olfr314	T	C	11: 58,786,341	S36P	probably damaging	Het
Olfr600	A	G	7: 103,346,857	S24P	probably damaging	Het
Olfr898	A	G	9: 38,349,371	N96S	possibly damaging	Het
Pdia4	A	T	6: 47,806,518	F197Y	probably damaging	Het
Phldb1	T	C	9: 44,715,852	D432G	probably damaging	Het
Pik3ca	A	G	3: 32,436,552	E116G	probably damaging	Het
Polq	T	C	16: 37,060,993	V1173A	probably benign	Het
Prkag2	T	C	5: 24,869,249	N246S	probably damaging	Het
Proser1	A	G	3: 53,477,860	S388G	probably benign	Het
Ralgps1	G	A	2: 33,174,447	R238*	probably null	Het
Rfx2	T	C	17: 56,777,071	D657G	probably damaging	Het
Ryr3	A	G	2: 112,662,555	F3724S	probably damaging	Het
Sh2d5	T	C	4: 138,259,228	S421P	probably damaging	Het
Slc17a2	C	A	13: 23,812,611	T33K	probably damaging	Het
St8sia5	A	G	18: 77,246,113	T156A	probably damaging	Het
Stk32c	T	C	7: 139,188,110	D85G	probably benign	Het
Tnks	A	G	8: 34,940,822	S251P	probably damaging	Het
Tnxb	T	A	17: 34,718,729	L3864Q	probably damaging	Het
Trim9	A	G	12: 70,346,604	Y189H	probably damaging	Het
Vmn1r77	T	G	7: 12,041,388	F30L	probably benign	Het
Wasf3	A	G	5: 146,466,792		probably null	Het
Wdr90	C	T	17: 25,855,658	C603Y	probably damaging	Het
Zdhhc25	T	C	15: 88,601,107	L215P	probably damaging	Het
Zeb1	C	T	18: 5,759,123	Q140*	probably null	Het
Zfp677	C	T	17: 21,397,700	L340F	probably benign	Het

Other mutations in Pou2f3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pou2f3	APN	9	43128893	missense	probably damaging	1.00
IGL00508:Pou2f3	APN	9	43139963	missense	probably benign	0.01
IGL00975:Pou2f3	APN	9	43137384	missense	probably benign
IGL01577:Pou2f3	APN	9	43146881	nonsense	probably null
IGL01871:Pou2f3	APN	9	43134473	splice site	probably benign
IGL02370:Pou2f3	APN	9	43137348	missense	probably damaging	1.00
IGL02674:Pou2f3	APN	9	43139333	missense	probably damaging	1.00
IGL02746:Pou2f3	APN	9	43146846	missense	probably benign	0.01
IGL02956:Pou2f3	APN	9	43142805	splice site	probably benign
IGL02962:Pou2f3	APN	9	43125089	utr 3 prime	probably benign
IGL03082:Pou2f3	APN	9	43146915	critical splice acceptor site	probably null
R0433:Pou2f3	UTSW	9	43127398	missense	probably benign	0.23
R0926:Pou2f3	UTSW	9	43146901	missense	probably damaging	1.00
R1956:Pou2f3	UTSW	9	43145237	missense	probably benign
R4782:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R4877:Pou2f3	UTSW	9	43139323	missense	possibly damaging	0.58
R5070:Pou2f3	UTSW	9	43145281	missense	possibly damaging	0.52
R5910:Pou2f3	UTSW	9	43134474	splice site	probably null
R6280:Pou2f3	UTSW	9	43139339	missense	probably damaging	1.00
R6280:Pou2f3	UTSW	9	43139340	missense	probably damaging	1.00
R6465:Pou2f3	UTSW	9	43139867	missense	probably damaging	1.00
R7084:Pou2f3	UTSW	9	43128893	missense	probably damaging	1.00
R7161:Pou2f3	UTSW	9	43139363	missense	probably damaging	1.00
R8036:Pou2f3	UTSW	9	43146908	missense	probably damaging	1.00
R8406:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R8912:Pou2f3	UTSW	9	43199039	missense	probably benign	0.00
R9224:Pou2f3	UTSW	9	43139399	missense	probably damaging	1.00
R9329:Pou2f3	UTSW	9	43128929	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCACAGTTAGGTTCTCCGAAAGC -3'
(R):5'- GCACTTGAGATGAATCCACTCGTCC -3'

Sequencing Primer
(F):5'- AGGTTCTCCGAAAGCTCTGG -3'
(R):5'- ggtgaagagacccaaataatttcag -3'

Posted On

2013-07-11