Incidental Mutation 'R7590:Mlip'
ID587362
Institutional Source Beutler Lab
Gene Symbol Mlip
Ensembl Gene ENSMUSG00000032355
Gene Namemuscular LMNA-interacting protein
Synonyms2310046A06Rik, CIP, cardiac ISL1-interacting protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R7590 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location77102081-77352969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77230043 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 527 (D527E)
Ref Sequence ENSEMBL: ENSMUSP00000138864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034910] [ENSMUST00000183955] [ENSMUST00000184006] [ENSMUST00000184138] [ENSMUST00000184316] [ENSMUST00000184322] [ENSMUST00000184415] [ENSMUST00000184848] [ENSMUST00000185039] [ENSMUST00000185144]
Predicted Effect probably benign
Transcript: ENSMUST00000034910
SMART Domains Protein: ENSMUSP00000034910
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 69 155 1.3e-24 PFAM
Pfam:MLIP 175 269 1.9e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183955
AA Change: D527E

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138864
Gene: ENSMUSG00000032355
AA Change: D527E

DomainStartEndE-ValueType
Pfam:MLIP 111 210 7.6e-37 PFAM
low complexity region 351 363 N/A INTRINSIC
low complexity region 375 387 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
low complexity region 437 455 N/A INTRINSIC
low complexity region 528 541 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
Pfam:MLIP 654 881 8.5e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184006
SMART Domains Protein: ENSMUSP00000139002
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 67 154 1.5e-37 PFAM
Pfam:MLIP 175 270 1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184138
SMART Domains Protein: ENSMUSP00000139188
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 67 157 3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184316
SMART Domains Protein: ENSMUSP00000138938
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 111 200 5.7e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184322
AA Change: D450E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139055
Gene: ENSMUSG00000032355
AA Change: D450E

DomainStartEndE-ValueType
Pfam:MLIP 59 149 5.3e-37 PFAM
low complexity region 274 286 N/A INTRINSIC
low complexity region 298 310 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 360 378 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
low complexity region 559 574 N/A INTRINSIC
Pfam:MLIP 577 683 5.8e-23 PFAM
Pfam:MLIP 681 775 6.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184415
SMART Domains Protein: ENSMUSP00000139251
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 119 374 1.1e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184848
SMART Domains Protein: ENSMUSP00000139242
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 67 154 3.7e-38 PFAM
Pfam:MLIP 153 227 5.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185039
SMART Domains Protein: ENSMUSP00000139109
Gene: ENSMUSG00000032355

DomainStartEndE-ValueType
Pfam:MLIP 119 207 3.9e-38 PFAM
Pfam:MLIP 205 279 6.4e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185144
AA Change: D483E

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139362
Gene: ENSMUSG00000032355
AA Change: D483E

DomainStartEndE-ValueType
Pfam:MLIP 67 166 6.3e-37 PFAM
low complexity region 307 319 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 375 386 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 592 607 N/A INTRINSIC
Pfam:MLIP 609 836 4.7e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased cardiac sensitivity to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,515 T1373S probably damaging Het
Bbox1 A T 2: 110,268,232 N333K probably benign Het
Bcl11b T A 12: 108,003,143 M1L probably benign Het
C1s2 T A 6: 124,632,128 I157F probably damaging Het
Casp1 T A 9: 5,306,710 M384K probably damaging Het
Chpt1 A G 10: 88,480,826 S257P probably damaging Het
Dennd4a G A 9: 64,888,587 G731D probably benign Het
Dlk2 A T 17: 46,298,683 S21C probably benign Het
Ell2 T C 13: 75,770,735 L620P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fip1l1 T C 5: 74,591,774 V414A probably benign Het
Fmo1 T A 1: 162,859,682 probably benign Het
Fyb2 A G 4: 104,945,246 N115S probably benign Het
Gdi2 A G 13: 3,564,611 T319A probably benign Het
Gm10471 G T 5: 26,085,766 H136N possibly damaging Het
Hecw1 A G 13: 14,264,083 V905A probably damaging Het
Ireb2 T A 9: 54,896,495 V490D probably benign Het
Lbr A G 1: 181,821,511 S348P probably damaging Het
Loxhd1 T A 18: 77,321,634 D191E possibly damaging Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5 G T 1: 126,026,533 Q761K probably benign Het
Neb A T 2: 52,243,842 D3376E probably damaging Het
Nek10 A G 14: 15,006,693 *1116W probably null Het
Olfr224 T C 11: 58,567,259 I29V probably benign Het
Olfr491 A T 7: 108,317,179 H95L probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
Pak2 A T 16: 32,052,196 I56K probably benign Het
Pgm5 T C 19: 24,709,265 Y526C probably damaging Het
Phc2 T A 4: 128,748,027 L714H probably damaging Het
Phf13 A T 4: 151,991,775 D223E probably damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rbm6 A T 9: 107,791,750 probably null Het
Scn10a A G 9: 119,666,400 M352T probably damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Slc13a4 T A 6: 35,279,463 I321F possibly damaging Het
Spata9 T C 13: 75,977,652 S85P possibly damaging Het
Ssb G A 2: 69,867,290 A122T probably benign Het
Ssfa2 G T 2: 79,658,110 V846F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Ten1 T C 11: 116,205,640 L40P possibly damaging Het
Tex10 A C 4: 48,467,725 V358G probably damaging Het
Tmprss11c A T 5: 86,239,473 H195Q probably benign Het
Tor4a A G 2: 25,195,798 V31A possibly damaging Het
Trim29 G A 9: 43,311,491 A206T probably damaging Het
Trim71 A C 9: 114,562,825 V98G probably benign Het
Trpm6 C G 19: 18,832,581 L1114V probably benign Het
Usp1 A G 4: 98,934,252 D601G possibly damaging Het
Vmn2r18 T A 5: 151,561,729 I767F probably damaging Het
Other mutations in Mlip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Mlip APN 9 77239417 missense possibly damaging 0.89
IGL01727:Mlip APN 9 77239748 missense probably damaging 0.99
IGL01918:Mlip APN 9 77173999 missense probably damaging 1.00
IGL02079:Mlip APN 9 77239529 missense possibly damaging 0.71
IGL02561:Mlip APN 9 77181351 critical splice donor site probably null
R0393:Mlip UTSW 9 77239577 missense probably benign 0.02
R2091:Mlip UTSW 9 77164863 missense possibly damaging 0.58
R3725:Mlip UTSW 9 77190380 missense probably damaging 1.00
R5334:Mlip UTSW 9 77243676 missense probably damaging 1.00
R5591:Mlip UTSW 9 77230482 missense probably damaging 0.96
R5592:Mlip UTSW 9 77230482 missense probably damaging 0.96
R5686:Mlip UTSW 9 77347693 critical splice donor site probably null
R5820:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6125:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6187:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6803:Mlip UTSW 9 77190381 missense probably damaging 0.99
R6860:Mlip UTSW 9 77102393 makesense probably null
R7031:Mlip UTSW 9 77138553 missense probably benign 0.03
R7206:Mlip UTSW 9 77164862 missense probably damaging 0.96
R7326:Mlip UTSW 9 77164842 missense probably benign 0.24
R7506:Mlip UTSW 9 77164803 missense probably damaging 1.00
R7509:Mlip UTSW 9 77181396 missense probably damaging 0.99
R7563:Mlip UTSW 9 77112997 missense probably damaging 0.99
R7615:Mlip UTSW 9 77230483 missense probably damaging 1.00
R7664:Mlip UTSW 9 77138546 missense possibly damaging 0.90
R7755:Mlip UTSW 9 77229556 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCTGTCTATCAGGTCTGAGAGG -3'
(R):5'- TTCTGCAGCGAGCTACCAAC -3'

Sequencing Primer
(F):5'- TATCAGGTCTGAGAGGGCCGG -3'
(R):5'- GCGAGCTACCAACCCTGC -3'
Posted On2019-10-24