Incidental Mutation 'R7590:Rbm6'
ID587363
Institutional Source Beutler Lab
Gene Symbol Rbm6
Ensembl Gene ENSMUSG00000032582
Gene NameRNA binding motif protein 6
Synonymsg16, NY-LU-12, Def-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R7590 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107773559-107873237 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 107791750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035201] [ENSMUST00000181986] [ENSMUST00000183032] [ENSMUST00000195883]
Predicted Effect probably null
Transcript: ENSMUST00000035201
SMART Domains Protein: ENSMUSP00000035201
Gene: ENSMUSG00000032582

DomainStartEndE-ValueType
internal_repeat_1 4 42 2.66e-5 PROSPERO
low complexity region 61 87 N/A INTRINSIC
internal_repeat_1 106 157 2.66e-5 PROSPERO
RRM 325 400 2.67e-2 SMART
Blast:ZnF_RBZ 406 430 2e-11 BLAST
RRM 522 601 1.32e-1 SMART
low complexity region 748 765 N/A INTRINSIC
ZnF_C2H2 818 843 4.34e0 SMART
low complexity region 864 876 N/A INTRINSIC
G_patch 912 958 7.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181986
Predicted Effect probably null
Transcript: ENSMUST00000183032
SMART Domains Protein: ENSMUSP00000138400
Gene: ENSMUSG00000032582

DomainStartEndE-ValueType
internal_repeat_1 43 119 2.42e-5 PROSPERO
internal_repeat_2 46 164 3.18e-5 PROSPERO
internal_repeat_1 121 189 2.42e-5 PROSPERO
low complexity region 193 219 N/A INTRINSIC
internal_repeat_2 224 319 3.18e-5 PROSPERO
RRM 457 532 2.67e-2 SMART
Blast:ZnF_RBZ 538 562 2e-9 BLAST
RRM 654 733 1.32e-1 SMART
low complexity region 880 897 N/A INTRINSIC
ZnF_C2H2 950 975 4.34e0 SMART
low complexity region 996 1008 N/A INTRINSIC
G_patch 1044 1090 7.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194436
Predicted Effect probably benign
Transcript: ENSMUST00000195883
SMART Domains Protein: ENSMUSP00000141953
Gene: ENSMUSG00000032582

DomainStartEndE-ValueType
Blast:ZnF_RBZ 24 48 9e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,515 T1373S probably damaging Het
Bbox1 A T 2: 110,268,232 N333K probably benign Het
Bcl11b T A 12: 108,003,143 M1L probably benign Het
C1s2 T A 6: 124,632,128 I157F probably damaging Het
Casp1 T A 9: 5,306,710 M384K probably damaging Het
Chpt1 A G 10: 88,480,826 S257P probably damaging Het
Dennd4a G A 9: 64,888,587 G731D probably benign Het
Dlk2 A T 17: 46,298,683 S21C probably benign Het
Ell2 T C 13: 75,770,735 L620P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fip1l1 T C 5: 74,591,774 V414A probably benign Het
Fmo1 T A 1: 162,859,682 probably benign Het
Fyb2 A G 4: 104,945,246 N115S probably benign Het
Gdi2 A G 13: 3,564,611 T319A probably benign Het
Gm10471 G T 5: 26,085,766 H136N possibly damaging Het
Hecw1 A G 13: 14,264,083 V905A probably damaging Het
Ireb2 T A 9: 54,896,495 V490D probably benign Het
Lbr A G 1: 181,821,511 S348P probably damaging Het
Loxhd1 T A 18: 77,321,634 D191E possibly damaging Het
Mlip A T 9: 77,230,043 D527E probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5 G T 1: 126,026,533 Q761K probably benign Het
Neb A T 2: 52,243,842 D3376E probably damaging Het
Nek10 A G 14: 15,006,693 *1116W probably null Het
Olfr224 T C 11: 58,567,259 I29V probably benign Het
Olfr491 A T 7: 108,317,179 H95L probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
Pak2 A T 16: 32,052,196 I56K probably benign Het
Pgm5 T C 19: 24,709,265 Y526C probably damaging Het
Phc2 T A 4: 128,748,027 L714H probably damaging Het
Phf13 A T 4: 151,991,775 D223E probably damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Scn10a A G 9: 119,666,400 M352T probably damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Slc13a4 T A 6: 35,279,463 I321F possibly damaging Het
Spata9 T C 13: 75,977,652 S85P possibly damaging Het
Ssb G A 2: 69,867,290 A122T probably benign Het
Ssfa2 G T 2: 79,658,110 V846F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Ten1 T C 11: 116,205,640 L40P possibly damaging Het
Tex10 A C 4: 48,467,725 V358G probably damaging Het
Tmprss11c A T 5: 86,239,473 H195Q probably benign Het
Tor4a A G 2: 25,195,798 V31A possibly damaging Het
Trim29 G A 9: 43,311,491 A206T probably damaging Het
Trim71 A C 9: 114,562,825 V98G probably benign Het
Trpm6 C G 19: 18,832,581 L1114V probably benign Het
Usp1 A G 4: 98,934,252 D601G possibly damaging Het
Vmn2r18 T A 5: 151,561,729 I767F probably damaging Het
Other mutations in Rbm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Rbm6 APN 9 107788349 missense probably damaging 1.00
IGL01647:Rbm6 APN 9 107852882 missense probably benign 0.13
IGL01872:Rbm6 APN 9 107783715 missense probably damaging 0.99
IGL02402:Rbm6 APN 9 107852852 missense probably damaging 1.00
IGL03024:Rbm6 APN 9 107787368 missense probably damaging 0.97
IGL03025:Rbm6 APN 9 107774719 missense possibly damaging 0.76
FR4737:Rbm6 UTSW 9 107782755 frame shift probably null
PIT4402001:Rbm6 UTSW 9 107787850 missense probably damaging 1.00
R0511:Rbm6 UTSW 9 107847289 nonsense probably null
R1666:Rbm6 UTSW 9 107791856 missense probably benign 0.15
R1927:Rbm6 UTSW 9 107852903 missense probably damaging 1.00
R2173:Rbm6 UTSW 9 107852191 missense possibly damaging 0.79
R2262:Rbm6 UTSW 9 107791090 missense probably damaging 1.00
R2439:Rbm6 UTSW 9 107779597 missense probably damaging 1.00
R2566:Rbm6 UTSW 9 107791998 missense possibly damaging 0.60
R2878:Rbm6 UTSW 9 107852450 missense probably damaging 1.00
R4342:Rbm6 UTSW 9 107847247 intron probably benign
R4783:Rbm6 UTSW 9 107852903 missense probably damaging 1.00
R4785:Rbm6 UTSW 9 107787352 missense probably benign 0.06
R5205:Rbm6 UTSW 9 107788343 missense probably benign 0.08
R5253:Rbm6 UTSW 9 107852657 missense probably damaging 1.00
R5279:Rbm6 UTSW 9 107778014 missense probably benign 0.00
R5356:Rbm6 UTSW 9 107852666 missense probably damaging 1.00
R6289:Rbm6 UTSW 9 107777948 missense probably damaging 1.00
R6328:Rbm6 UTSW 9 107787259 missense probably benign 0.00
R6564:Rbm6 UTSW 9 107833498 missense probably damaging 1.00
R6887:Rbm6 UTSW 9 107852231 missense probably damaging 1.00
R6978:Rbm6 UTSW 9 107852575 intron probably null
R7139:Rbm6 UTSW 9 107853211 missense probably damaging 1.00
R7240:Rbm6 UTSW 9 107852896 missense probably damaging 1.00
R7330:Rbm6 UTSW 9 107791045 missense possibly damaging 0.77
R7397:Rbm6 UTSW 9 107852519 missense probably benign
R7829:Rbm6 UTSW 9 107852706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCAAGAACTTAATGGCC -3'
(R):5'- CCTGCTGATAAGGAGCATGAAC -3'

Sequencing Primer
(F):5'- GGCATCAGATCTCATTACGGG -3'
(R):5'- TGCTGATAAGGAGCATGAACTCAGG -3'
Posted On2019-10-24