Incidental Mutation 'R7590:Trim71'
ID587364
Institutional Source Beutler Lab
Gene Symbol Trim71
Ensembl Gene ENSMUSG00000079259
Gene Nametripartite motif-containing 71
SynonymsmLin41, 636931, Lin41, 2610206G21Rik, LOC382112, lin-41, mlin-41
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7590 (G1)
Quality Score142.008
Status Not validated
Chromosome9
Chromosomal Location114507133-114564369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 114562825 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 98 (V98G)
Ref Sequence ENSEMBL: ENSMUSP00000107447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111816]
Predicted Effect probably benign
Transcript: ENSMUST00000111816
AA Change: V98G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107447
Gene: ENSMUSG00000079259
AA Change: V98G

DomainStartEndE-ValueType
RING 12 93 7.16e-6 SMART
low complexity region 129 176 N/A INTRINSIC
BBOX 181 230 1.49e-1 SMART
BBOX 260 301 4.54e-8 SMART
Blast:BBC 325 433 1e-9 BLAST
IG_FLMN 470 570 5.04e-24 SMART
Pfam:NHL 593 620 2.9e-12 PFAM
Pfam:NHL 640 667 1.8e-9 PFAM
Pfam:NHL 687 714 4.4e-12 PFAM
Pfam:NHL 734 761 1.4e-10 PFAM
Pfam:NHL 781 808 4.4e-12 PFAM
Pfam:NHL 828 855 8.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that binds with miRNAs and maintains the growth and upkeep of embryonic stem cells. This gene also is involved in the G1-S phase transition of the cell cycle. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous gene trap mutations of this gene result in failure of cranial neural tube closure and embryonic lethality. Homozygotes for a gene trap allele exhibit exencephaly, abnormal nasal process and facial prominence, reduced brain size, and embryonic or fetal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,515 T1373S probably damaging Het
Bbox1 A T 2: 110,268,232 N333K probably benign Het
Bcl11b T A 12: 108,003,143 M1L probably benign Het
C1s2 T A 6: 124,632,128 I157F probably damaging Het
Casp1 T A 9: 5,306,710 M384K probably damaging Het
Chpt1 A G 10: 88,480,826 S257P probably damaging Het
Dennd4a G A 9: 64,888,587 G731D probably benign Het
Dlk2 A T 17: 46,298,683 S21C probably benign Het
Ell2 T C 13: 75,770,735 L620P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fip1l1 T C 5: 74,591,774 V414A probably benign Het
Fmo1 T A 1: 162,859,682 probably benign Het
Fyb2 A G 4: 104,945,246 N115S probably benign Het
Gdi2 A G 13: 3,564,611 T319A probably benign Het
Gm10471 G T 5: 26,085,766 H136N possibly damaging Het
Hecw1 A G 13: 14,264,083 V905A probably damaging Het
Ireb2 T A 9: 54,896,495 V490D probably benign Het
Lbr A G 1: 181,821,511 S348P probably damaging Het
Loxhd1 T A 18: 77,321,634 D191E possibly damaging Het
Mlip A T 9: 77,230,043 D527E probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5 G T 1: 126,026,533 Q761K probably benign Het
Neb A T 2: 52,243,842 D3376E probably damaging Het
Nek10 A G 14: 15,006,693 *1116W probably null Het
Olfr224 T C 11: 58,567,259 I29V probably benign Het
Olfr491 A T 7: 108,317,179 H95L probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
Pak2 A T 16: 32,052,196 I56K probably benign Het
Pgm5 T C 19: 24,709,265 Y526C probably damaging Het
Phc2 T A 4: 128,748,027 L714H probably damaging Het
Phf13 A T 4: 151,991,775 D223E probably damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rbm6 A T 9: 107,791,750 probably null Het
Scn10a A G 9: 119,666,400 M352T probably damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Slc13a4 T A 6: 35,279,463 I321F possibly damaging Het
Spata9 T C 13: 75,977,652 S85P possibly damaging Het
Ssb G A 2: 69,867,290 A122T probably benign Het
Ssfa2 G T 2: 79,658,110 V846F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Ten1 T C 11: 116,205,640 L40P possibly damaging Het
Tex10 A C 4: 48,467,725 V358G probably damaging Het
Tmprss11c A T 5: 86,239,473 H195Q probably benign Het
Tor4a A G 2: 25,195,798 V31A possibly damaging Het
Trim29 G A 9: 43,311,491 A206T probably damaging Het
Trpm6 C G 19: 18,832,581 L1114V probably benign Het
Usp1 A G 4: 98,934,252 D601G possibly damaging Het
Vmn2r18 T A 5: 151,561,729 I767F probably damaging Het
Other mutations in Trim71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Trim71 APN 9 114525015 missense probably benign 0.19
IGL02060:Trim71 APN 9 114513253 missense possibly damaging 0.55
R1858:Trim71 UTSW 9 114562948 missense possibly damaging 0.86
R2161:Trim71 UTSW 9 114512772 missense probably damaging 1.00
R2409:Trim71 UTSW 9 114513713 missense possibly damaging 0.89
R3034:Trim71 UTSW 9 114512844 missense probably damaging 1.00
R3843:Trim71 UTSW 9 114515846 missense probably benign 0.00
R6786:Trim71 UTSW 9 114512704 missense probably benign 0.05
R6846:Trim71 UTSW 9 114525047 missense probably damaging 1.00
R7524:Trim71 UTSW 9 114513162 missense probably benign 0.35
R7559:Trim71 UTSW 9 114513042 missense probably damaging 1.00
X0065:Trim71 UTSW 9 114513115 missense probably benign 0.07
Z1177:Trim71 UTSW 9 114513481 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGTTGTCGCACAGGTGTTC -3'
(R):5'- TGCTGTGCAAGGAGATGTGC -3'

Sequencing Primer
(F):5'- TGTTCCTGGCAGTCGAGGC -3'
(R):5'- TCGCAGACTTCCACGTCG -3'
Posted On2019-10-24