Incidental Mutation 'R7590:Ell2'
ID587373
Institutional Source Beutler Lab
Gene Symbol Ell2
Ensembl Gene ENSMUSG00000001542
Gene Nameelongation factor RNA polymerase II 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7590 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location75706757-75772364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75770735 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 620 (L620P)
Ref Sequence ENSEMBL: ENSMUSP00000001583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001583] [ENSMUST00000222194]
Predicted Effect probably damaging
Transcript: ENSMUST00000001583
AA Change: L620P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001583
Gene: ENSMUSG00000001542
AA Change: L620P

DomainStartEndE-ValueType
Pfam:ELL 11 291 2.4e-108 PFAM
low complexity region 362 401 N/A INTRINSIC
low complexity region 451 476 N/A INTRINSIC
Pfam:Occludin_ELL 531 632 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222194
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,938,515 T1373S probably damaging Het
Bbox1 A T 2: 110,268,232 N333K probably benign Het
Bcl11b T A 12: 108,003,143 M1L probably benign Het
C1s2 T A 6: 124,632,128 I157F probably damaging Het
Casp1 T A 9: 5,306,710 M384K probably damaging Het
Chpt1 A G 10: 88,480,826 S257P probably damaging Het
Dennd4a G A 9: 64,888,587 G731D probably benign Het
Dlk2 A T 17: 46,298,683 S21C probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fip1l1 T C 5: 74,591,774 V414A probably benign Het
Fmo1 T A 1: 162,859,682 probably benign Het
Fyb2 A G 4: 104,945,246 N115S probably benign Het
Gdi2 A G 13: 3,564,611 T319A probably benign Het
Gm10471 G T 5: 26,085,766 H136N possibly damaging Het
Hecw1 A G 13: 14,264,083 V905A probably damaging Het
Ireb2 T A 9: 54,896,495 V490D probably benign Het
Lbr A G 1: 181,821,511 S348P probably damaging Het
Loxhd1 T A 18: 77,321,634 D191E possibly damaging Het
Mlip A T 9: 77,230,043 D527E probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5 G T 1: 126,026,533 Q761K probably benign Het
Neb A T 2: 52,243,842 D3376E probably damaging Het
Nek10 A G 14: 15,006,693 *1116W probably null Het
Olfr224 T C 11: 58,567,259 I29V probably benign Het
Olfr491 A T 7: 108,317,179 H95L probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
Pak2 A T 16: 32,052,196 I56K probably benign Het
Pgm5 T C 19: 24,709,265 Y526C probably damaging Het
Phc2 T A 4: 128,748,027 L714H probably damaging Het
Phf13 A T 4: 151,991,775 D223E probably damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rbm6 A T 9: 107,791,750 probably null Het
Scn10a A G 9: 119,666,400 M352T probably damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Slc13a4 T A 6: 35,279,463 I321F possibly damaging Het
Spata9 T C 13: 75,977,652 S85P possibly damaging Het
Ssb G A 2: 69,867,290 A122T probably benign Het
Ssfa2 G T 2: 79,658,110 V846F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Ten1 T C 11: 116,205,640 L40P possibly damaging Het
Tex10 A C 4: 48,467,725 V358G probably damaging Het
Tmprss11c A T 5: 86,239,473 H195Q probably benign Het
Tor4a A G 2: 25,195,798 V31A possibly damaging Het
Trim29 G A 9: 43,311,491 A206T probably damaging Het
Trim71 A C 9: 114,562,825 V98G probably benign Het
Trpm6 C G 19: 18,832,581 L1114V probably benign Het
Usp1 A G 4: 98,934,252 D601G possibly damaging Het
Vmn2r18 T A 5: 151,561,729 I767F probably damaging Het
Other mutations in Ell2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ell2 APN 13 75756290 missense probably damaging 1.00
IGL01315:Ell2 APN 13 75762232 unclassified probably benign
IGL01446:Ell2 APN 13 75761991 missense probably benign 0.02
IGL02691:Ell2 APN 13 75756486 missense probably damaging 0.97
IGL02963:Ell2 APN 13 75769643 missense possibly damaging 0.48
IGL03035:Ell2 APN 13 75763648 nonsense probably null
PIT4469001:Ell2 UTSW 13 75761892 missense probably damaging 0.99
R0123:Ell2 UTSW 13 75762140 splice site probably benign
R0321:Ell2 UTSW 13 75761888 missense probably damaging 1.00
R0594:Ell2 UTSW 13 75749993 missense probably damaging 1.00
R0892:Ell2 UTSW 13 75763639 missense probably damaging 0.97
R1078:Ell2 UTSW 13 75746419 splice site probably benign
R1696:Ell2 UTSW 13 75769558 missense probably damaging 1.00
R2325:Ell2 UTSW 13 75769626 missense probably damaging 1.00
R2886:Ell2 UTSW 13 75763785 missense probably damaging 1.00
R3760:Ell2 UTSW 13 75762162 missense probably benign 0.37
R4206:Ell2 UTSW 13 75761948 missense probably damaging 1.00
R4632:Ell2 UTSW 13 75769574 missense possibly damaging 0.84
R5068:Ell2 UTSW 13 75763618 missense probably benign 0.00
R6980:Ell2 UTSW 13 75756376 missense probably null
R6983:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R6984:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R6986:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7073:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7074:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7473:Ell2 UTSW 13 75750035 missense probably damaging 1.00
RF018:Ell2 UTSW 13 75763608 missense probably damaging 1.00
Z1088:Ell2 UTSW 13 75761873 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CCTTCCAGGTGCTTGTTAGATATAG -3'
(R):5'- AGCTTCAAAATTCAGGGCAGC -3'

Sequencing Primer
(F):5'- GAATGTTCATGAAGAAGTCTTACAGG -3'
(R):5'- TTCAGGGCAGCAAAGTAAAATAG -3'
Posted On2019-10-24