Incidental Mutation 'R7590:Nek10'
ID 587378
Institutional Source Beutler Lab
Gene Symbol Nek10
Ensembl Gene ENSMUSG00000042567
Gene Name NIMA (never in mitosis gene a)- related kinase 10
Synonyms LOC238944
MMRRC Submission 045669-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7590 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 7457704-7666183 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 15006693 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 1116 (*1116W)
Ref Sequence ENSEMBL: ENSMUSP00000108249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000224491]
AlphaFold Q3UGM2
Predicted Effect probably null
Transcript: ENSMUST00000112630
AA Change: *1116W
SMART Domains Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: *1116W

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136826
SMART Domains Protein: ENSMUSP00000123151
Gene: ENSMUSG00000042567

DomainStartEndE-ValueType
Pfam:Pkinase 1 87 5.1e-13 PFAM
Pfam:Pkinase_Tyr 1 87 4.2e-8 PFAM
low complexity region 103 115 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224491
AA Change: *1116W
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,829,341 (GRCm39) T1373S probably damaging Het
Bbox1 A T 2: 110,098,577 (GRCm39) N333K probably benign Het
Bcl11b T A 12: 107,969,402 (GRCm39) M1L probably benign Het
C1s2 T A 6: 124,609,087 (GRCm39) I157F probably damaging Het
Casp1 T A 9: 5,306,710 (GRCm39) M384K probably damaging Het
Chpt1 A G 10: 88,316,688 (GRCm39) S257P probably damaging Het
Dennd4a G A 9: 64,795,869 (GRCm39) G731D probably benign Het
Dlk2 A T 17: 46,609,609 (GRCm39) S21C probably benign Het
Ell2 T C 13: 75,918,854 (GRCm39) L620P probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Fip1l1 T C 5: 74,752,435 (GRCm39) V414A probably benign Het
Fmo1 T A 1: 162,687,251 (GRCm39) probably benign Het
Fyb2 A G 4: 104,802,443 (GRCm39) N115S probably benign Het
Gdi2 A G 13: 3,614,611 (GRCm39) T319A probably benign Het
Hecw1 A G 13: 14,438,668 (GRCm39) V905A probably damaging Het
Ireb2 T A 9: 54,803,779 (GRCm39) V490D probably benign Het
Itprid2 G T 2: 79,488,454 (GRCm39) V846F possibly damaging Het
Lbr A G 1: 181,649,076 (GRCm39) S348P probably damaging Het
Loxhd1 T A 18: 77,409,330 (GRCm39) D191E possibly damaging Het
Mlip A T 9: 77,137,325 (GRCm39) D527E probably benign Het
Myom2 A G 8: 15,167,679 (GRCm39) Y1088C probably damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Nckap5 G T 1: 125,954,270 (GRCm39) Q761K probably benign Het
Neb A T 2: 52,133,854 (GRCm39) D3376E probably damaging Het
Or2t43 T C 11: 58,458,085 (GRCm39) I29V probably benign Het
Or52d3 T C 7: 104,229,149 (GRCm39) S99P probably damaging Het
Or5p1 A T 7: 107,916,386 (GRCm39) H95L probably benign Het
Pak2 A T 16: 31,871,014 (GRCm39) I56K probably benign Het
Pgm5 T C 19: 24,686,629 (GRCm39) Y526C probably damaging Het
Phc2 T A 4: 128,641,820 (GRCm39) L714H probably damaging Het
Phf13 A T 4: 152,076,232 (GRCm39) D223E probably damaging Het
Pkd1l2 T C 8: 117,807,525 (GRCm39) D171G probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 (GRCm38) probably null Het
Rbm6 A T 9: 107,668,949 (GRCm39) probably null Het
Scn10a A G 9: 119,495,466 (GRCm39) M352T probably damaging Het
Sh3d19 G A 3: 86,022,213 (GRCm39) V548I possibly damaging Het
Slc13a4 T A 6: 35,256,398 (GRCm39) I321F possibly damaging Het
Spata9 T C 13: 76,125,771 (GRCm39) S85P possibly damaging Het
Speer4a2 G T 5: 26,290,764 (GRCm39) H136N possibly damaging Het
Ssb G A 2: 69,697,634 (GRCm39) A122T probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Ten1 T C 11: 116,096,466 (GRCm39) L40P possibly damaging Het
Tex10 A C 4: 48,467,725 (GRCm39) V358G probably damaging Het
Tmprss11c A T 5: 86,387,332 (GRCm39) H195Q probably benign Het
Tor4a A G 2: 25,085,810 (GRCm39) V31A possibly damaging Het
Trim29 G A 9: 43,222,788 (GRCm39) A206T probably damaging Het
Trim71 A C 9: 114,391,893 (GRCm39) V98G probably benign Het
Trpm6 C G 19: 18,809,945 (GRCm39) L1114V probably benign Het
Usp1 A G 4: 98,822,489 (GRCm39) D601G possibly damaging Het
Vmn2r18 T A 5: 151,485,194 (GRCm39) I767F probably damaging Het
Other mutations in Nek10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Nek10 APN 14 14,850,957 (GRCm38) missense probably damaging 0.99
IGL02067:Nek10 APN 14 14,861,639 (GRCm38) missense probably benign 0.12
IGL02361:Nek10 APN 14 14,843,856 (GRCm38) missense probably damaging 1.00
IGL02687:Nek10 APN 14 14,840,570 (GRCm38) missense probably damaging 1.00
IGL02929:Nek10 APN 14 14,821,119 (GRCm38) missense possibly damaging 0.82
IGL03229:Nek10 APN 14 14,986,686 (GRCm38) missense probably benign 0.10
P0041:Nek10 UTSW 14 14,861,603 (GRCm38) missense probably benign 0.01
R0007:Nek10 UTSW 14 14,840,574 (GRCm38) missense probably benign 0.10
R0007:Nek10 UTSW 14 14,840,574 (GRCm38) missense probably benign 0.10
R0142:Nek10 UTSW 14 14,861,560 (GRCm38) missense possibly damaging 0.96
R0433:Nek10 UTSW 14 14,860,927 (GRCm38) missense probably benign 0.32
R0633:Nek10 UTSW 14 14,857,782 (GRCm38) critical splice acceptor site probably null
R1087:Nek10 UTSW 14 14,827,059 (GRCm38) missense possibly damaging 0.59
R1184:Nek10 UTSW 14 14,931,325 (GRCm38) splice site probably benign
R1250:Nek10 UTSW 14 14,853,887 (GRCm38) missense probably damaging 1.00
R1371:Nek10 UTSW 14 14,850,983 (GRCm38) missense probably damaging 0.98
R1506:Nek10 UTSW 14 14,999,078 (GRCm38) splice site probably benign
R1829:Nek10 UTSW 14 14,863,454 (GRCm38) critical splice acceptor site probably null
R1831:Nek10 UTSW 14 14,842,789 (GRCm38) missense probably benign
R1833:Nek10 UTSW 14 14,842,789 (GRCm38) missense probably benign
R1990:Nek10 UTSW 14 14,860,764 (GRCm38) missense probably benign
R1997:Nek10 UTSW 14 14,827,003 (GRCm38) missense probably benign 0.09
R2011:Nek10 UTSW 14 14,885,122 (GRCm38) missense probably damaging 1.00
R2158:Nek10 UTSW 14 14,885,047 (GRCm38) splice site probably null
R2288:Nek10 UTSW 14 14,853,956 (GRCm38) nonsense probably null
R2568:Nek10 UTSW 14 14,999,112 (GRCm38) missense possibly damaging 0.89
R2907:Nek10 UTSW 14 14,980,613 (GRCm38) missense possibly damaging 0.81
R2965:Nek10 UTSW 14 14,836,202 (GRCm38) missense probably damaging 1.00
R3922:Nek10 UTSW 14 14,861,585 (GRCm38) missense possibly damaging 0.88
R4032:Nek10 UTSW 14 14,853,877 (GRCm38) splice site probably null
R4700:Nek10 UTSW 14 14,842,841 (GRCm38) missense possibly damaging 0.69
R4742:Nek10 UTSW 14 14,861,624 (GRCm38) missense probably null 0.03
R4785:Nek10 UTSW 14 14,855,714 (GRCm38) missense probably benign
R4890:Nek10 UTSW 14 14,860,986 (GRCm38) missense possibly damaging 0.47
R4891:Nek10 UTSW 14 14,860,986 (GRCm38) missense possibly damaging 0.47
R4920:Nek10 UTSW 14 14,860,986 (GRCm38) missense possibly damaging 0.47
R4924:Nek10 UTSW 14 14,846,594 (GRCm38) splice site probably null
R4928:Nek10 UTSW 14 14,930,577 (GRCm38) missense probably damaging 1.00
R4948:Nek10 UTSW 14 14,860,986 (GRCm38) missense possibly damaging 0.47
R4952:Nek10 UTSW 14 14,860,986 (GRCm38) missense possibly damaging 0.47
R4953:Nek10 UTSW 14 14,860,986 (GRCm38) missense possibly damaging 0.47
R5092:Nek10 UTSW 14 14,820,851 (GRCm38) missense possibly damaging 0.81
R5097:Nek10 UTSW 14 14,857,851 (GRCm38) missense probably benign 0.00
R5593:Nek10 UTSW 14 14,980,544 (GRCm38) nonsense probably null
R5696:Nek10 UTSW 14 14,860,736 (GRCm38) splice site probably null
R5813:Nek10 UTSW 14 14,986,704 (GRCm38) missense probably benign 0.01
R5829:Nek10 UTSW 14 14,865,404 (GRCm38) missense probably damaging 1.00
R5872:Nek10 UTSW 14 14,850,896 (GRCm38) missense probably benign 0.06
R5939:Nek10 UTSW 14 14,931,290 (GRCm38) missense possibly damaging 0.58
R6025:Nek10 UTSW 14 14,865,633 (GRCm38) missense probably benign 0.41
R6235:Nek10 UTSW 14 14,821,113 (GRCm38) nonsense probably null
R6539:Nek10 UTSW 14 14,860,789 (GRCm38) missense possibly damaging 0.94
R6542:Nek10 UTSW 14 14,999,108 (GRCm38) missense probably benign 0.44
R6561:Nek10 UTSW 14 14,828,448 (GRCm38) missense possibly damaging 0.48
R6659:Nek10 UTSW 14 14,861,684 (GRCm38) missense probably benign 0.29
R7039:Nek10 UTSW 14 14,986,700 (GRCm38) missense probably damaging 0.99
R7039:Nek10 UTSW 14 14,826,946 (GRCm38) missense possibly damaging 0.63
R7102:Nek10 UTSW 14 14,828,517 (GRCm38) missense probably damaging 1.00
R7185:Nek10 UTSW 14 14,846,621 (GRCm38) missense probably benign 0.03
R7198:Nek10 UTSW 14 14,850,947 (GRCm38) missense probably damaging 0.99
R7202:Nek10 UTSW 14 14,836,171 (GRCm38) missense probably benign 0.01
R7251:Nek10 UTSW 14 14,853,965 (GRCm38) missense probably benign
R7345:Nek10 UTSW 14 14,955,503 (GRCm38) missense probably benign
R7593:Nek10 UTSW 14 14,826,955 (GRCm38) missense probably benign 0.04
R7616:Nek10 UTSW 14 14,937,759 (GRCm38) missense probably benign 0.27
R7635:Nek10 UTSW 14 14,850,932 (GRCm38) missense probably benign 0.01
R7817:Nek10 UTSW 14 15,001,017 (GRCm38) missense probably benign 0.00
R7826:Nek10 UTSW 14 14,860,846 (GRCm38) splice site probably null
R7986:Nek10 UTSW 14 15,001,020 (GRCm38) missense probably benign 0.17
R8765:Nek10 UTSW 14 14,999,104 (GRCm38) missense probably damaging 0.97
R8856:Nek10 UTSW 14 14,937,610 (GRCm38) missense probably damaging 0.96
R8973:Nek10 UTSW 14 14,931,321 (GRCm38) critical splice donor site probably null
R9002:Nek10 UTSW 14 14,980,590 (GRCm38) missense probably damaging 1.00
R9088:Nek10 UTSW 14 14,931,314 (GRCm38) missense probably damaging 1.00
R9195:Nek10 UTSW 14 14,821,139 (GRCm38) missense probably benign 0.03
R9464:Nek10 UTSW 14 14,937,766 (GRCm38) missense probably benign
R9511:Nek10 UTSW 14 14,828,511 (GRCm38) missense probably benign 0.05
R9529:Nek10 UTSW 14 14,850,833 (GRCm38) missense probably benign
R9590:Nek10 UTSW 14 14,853,888 (GRCm38) missense probably damaging 1.00
Z1177:Nek10 UTSW 14 15,001,157 (GRCm38) nonsense probably null
Z1177:Nek10 UTSW 14 14,853,948 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGCAAAAGATCAGAGCTCTC -3'
(R):5'- ATGTTTTCTCCCAGAAGTACACTG -3'

Sequencing Primer
(F):5'- TCTGAGAGCTCCCATTTTATGAG -3'
(R):5'- CATGCAATGCACACTGGG -3'
Posted On 2019-10-24