Incidental Mutation 'R7590:Loxhd1'
ID 587383
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Name lipoxygenase homology domains 1
Synonyms 1700096C21Rik, sba
MMRRC Submission 045669-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R7590 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 77369654-77530626 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77409330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 191 (D191E)
Ref Sequence ENSEMBL: ENSMUSP00000094294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035501] [ENSMUST00000096547]
AlphaFold C8YR32
Predicted Effect probably benign
Transcript: ENSMUST00000035501
SMART Domains Protein: ENSMUSP00000045450
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
Pfam:PLAT 1 53 3.2e-7 PFAM
LH2 63 176 1.1e-4 SMART
LH2 192 306 4.02e-4 SMART
LH2 320 442 3.79e-6 SMART
LH2 451 567 5.92e-6 SMART
LH2 581 696 7.67e-3 SMART
LH2 793 913 1.47e-11 SMART
low complexity region 922 931 N/A INTRINSIC
SCOP:d1lox_2 949 974 1e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000096547
AA Change: D191E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: D191E

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,829,341 (GRCm39) T1373S probably damaging Het
Bbox1 A T 2: 110,098,577 (GRCm39) N333K probably benign Het
Bcl11b T A 12: 107,969,402 (GRCm39) M1L probably benign Het
C1s2 T A 6: 124,609,087 (GRCm39) I157F probably damaging Het
Casp1 T A 9: 5,306,710 (GRCm39) M384K probably damaging Het
Chpt1 A G 10: 88,316,688 (GRCm39) S257P probably damaging Het
Dennd4a G A 9: 64,795,869 (GRCm39) G731D probably benign Het
Dlk2 A T 17: 46,609,609 (GRCm39) S21C probably benign Het
Ell2 T C 13: 75,918,854 (GRCm39) L620P probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Fip1l1 T C 5: 74,752,435 (GRCm39) V414A probably benign Het
Fmo1 T A 1: 162,687,251 (GRCm39) probably benign Het
Fyb2 A G 4: 104,802,443 (GRCm39) N115S probably benign Het
Gdi2 A G 13: 3,614,611 (GRCm39) T319A probably benign Het
Hecw1 A G 13: 14,438,668 (GRCm39) V905A probably damaging Het
Ireb2 T A 9: 54,803,779 (GRCm39) V490D probably benign Het
Itprid2 G T 2: 79,488,454 (GRCm39) V846F possibly damaging Het
Lbr A G 1: 181,649,076 (GRCm39) S348P probably damaging Het
Mlip A T 9: 77,137,325 (GRCm39) D527E probably benign Het
Myom2 A G 8: 15,167,679 (GRCm39) Y1088C probably damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Nckap5 G T 1: 125,954,270 (GRCm39) Q761K probably benign Het
Neb A T 2: 52,133,854 (GRCm39) D3376E probably damaging Het
Nek10 A G 14: 15,006,693 (GRCm38) *1116W probably null Het
Or2t43 T C 11: 58,458,085 (GRCm39) I29V probably benign Het
Or52d3 T C 7: 104,229,149 (GRCm39) S99P probably damaging Het
Or5p1 A T 7: 107,916,386 (GRCm39) H95L probably benign Het
Pak2 A T 16: 31,871,014 (GRCm39) I56K probably benign Het
Pgm5 T C 19: 24,686,629 (GRCm39) Y526C probably damaging Het
Phc2 T A 4: 128,641,820 (GRCm39) L714H probably damaging Het
Phf13 A T 4: 152,076,232 (GRCm39) D223E probably damaging Het
Pkd1l2 T C 8: 117,807,525 (GRCm39) D171G probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 (GRCm38) probably null Het
Rbm6 A T 9: 107,668,949 (GRCm39) probably null Het
Scn10a A G 9: 119,495,466 (GRCm39) M352T probably damaging Het
Sh3d19 G A 3: 86,022,213 (GRCm39) V548I possibly damaging Het
Slc13a4 T A 6: 35,256,398 (GRCm39) I321F possibly damaging Het
Spata9 T C 13: 76,125,771 (GRCm39) S85P possibly damaging Het
Speer4a2 G T 5: 26,290,764 (GRCm39) H136N possibly damaging Het
Ssb G A 2: 69,697,634 (GRCm39) A122T probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Ten1 T C 11: 116,096,466 (GRCm39) L40P possibly damaging Het
Tex10 A C 4: 48,467,725 (GRCm39) V358G probably damaging Het
Tmprss11c A T 5: 86,387,332 (GRCm39) H195Q probably benign Het
Tor4a A G 2: 25,085,810 (GRCm39) V31A possibly damaging Het
Trim29 G A 9: 43,222,788 (GRCm39) A206T probably damaging Het
Trim71 A C 9: 114,391,893 (GRCm39) V98G probably benign Het
Trpm6 C G 19: 18,809,945 (GRCm39) L1114V probably benign Het
Usp1 A G 4: 98,822,489 (GRCm39) D601G possibly damaging Het
Vmn2r18 T A 5: 151,485,194 (GRCm39) I767F probably damaging Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77,483,146 (GRCm39) missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77,518,770 (GRCm39) missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77,420,263 (GRCm39) missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77,493,672 (GRCm39) missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77,416,897 (GRCm39) missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77,374,120 (GRCm39) missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77,427,797 (GRCm39) missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77,456,833 (GRCm39) missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77,490,648 (GRCm39) missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77,498,235 (GRCm39) missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77,493,628 (GRCm39) missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77,444,609 (GRCm39) missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77,456,811 (GRCm39) splice site probably benign
IGL03032:Loxhd1 APN 18 77,374,169 (GRCm39) missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77,529,480 (GRCm39) missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77,518,809 (GRCm39) missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77,468,160 (GRCm39) missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77,496,446 (GRCm39) missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77,529,369 (GRCm39) missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77,429,627 (GRCm39) missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77,529,464 (GRCm39) missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77,427,196 (GRCm39) missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77,427,196 (GRCm39) missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77,496,474 (GRCm39) missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77,468,256 (GRCm39) splice site probably benign
R0049:Loxhd1 UTSW 18 77,468,256 (GRCm39) splice site probably benign
R0206:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77,456,833 (GRCm39) missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77,471,526 (GRCm39) splice site probably null
R0367:Loxhd1 UTSW 18 77,513,453 (GRCm39) splice site probably benign
R0709:Loxhd1 UTSW 18 77,492,665 (GRCm39) missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77,517,680 (GRCm39) missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77,517,639 (GRCm39) missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77,493,699 (GRCm39) critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77,490,632 (GRCm39) missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77,468,269 (GRCm39) splice site probably null
R1465:Loxhd1 UTSW 18 77,468,269 (GRCm39) splice site probably null
R1501:Loxhd1 UTSW 18 77,444,528 (GRCm39) missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77,490,259 (GRCm39) missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77,409,364 (GRCm39) missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77,492,498 (GRCm39) missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77,380,937 (GRCm39) missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77,492,585 (GRCm39) missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77,513,335 (GRCm39) missense possibly damaging 0.88
R1796:Loxhd1 UTSW 18 77,493,603 (GRCm39) missense probably damaging 0.96
R1800:Loxhd1 UTSW 18 77,490,198 (GRCm39) missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77,369,667 (GRCm39) missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77,427,833 (GRCm39) missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77,492,504 (GRCm39) missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77,409,338 (GRCm39) missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77,383,465 (GRCm39) missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77,472,642 (GRCm39) missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77,443,862 (GRCm39) missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77,518,774 (GRCm39) missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77,469,719 (GRCm39) missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77,496,464 (GRCm39) missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77,501,855 (GRCm39) missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77,460,025 (GRCm39) missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77,460,025 (GRCm39) missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77,418,755 (GRCm39) missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77,486,697 (GRCm39) missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77,483,123 (GRCm39) missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77,460,607 (GRCm39) missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77,529,456 (GRCm39) missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77,518,828 (GRCm39) missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77,486,785 (GRCm39) missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77,444,608 (GRCm39) missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77,493,642 (GRCm39) missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77,490,581 (GRCm39) missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77,459,987 (GRCm39) missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77,483,153 (GRCm39) missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77,472,663 (GRCm39) missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77,449,432 (GRCm39) missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77,451,308 (GRCm39) missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77,498,268 (GRCm39) missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77,420,378 (GRCm39) missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77,454,237 (GRCm39) missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77,429,751 (GRCm39) missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77,492,647 (GRCm39) missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77,444,573 (GRCm39) missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77,374,105 (GRCm39) missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77,490,211 (GRCm39) missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77,499,946 (GRCm39) missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77,469,254 (GRCm39) missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77,469,254 (GRCm39) missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77,383,454 (GRCm39) missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77,499,874 (GRCm39) missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77,449,426 (GRCm39) missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77,468,128 (GRCm39) missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77,499,847 (GRCm39) missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77,380,965 (GRCm39) missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77,518,873 (GRCm39) missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77,529,222 (GRCm39) missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77,460,129 (GRCm39) critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77,476,210 (GRCm39) missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77,501,892 (GRCm39) missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77,529,513 (GRCm39) missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77,420,338 (GRCm39) missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77,383,547 (GRCm39) missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77,500,001 (GRCm39) missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77,483,061 (GRCm39) missense probably damaging 0.99
R7612:Loxhd1 UTSW 18 77,517,671 (GRCm39) missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77,518,882 (GRCm39) missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77,472,637 (GRCm39) missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77,471,425 (GRCm39) missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77,496,483 (GRCm39) missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77,518,909 (GRCm39) missense probably damaging 0.98
R7960:Loxhd1 UTSW 18 77,472,746 (GRCm39) missense probably damaging 0.99
R7986:Loxhd1 UTSW 18 77,462,890 (GRCm39) missense possibly damaging 0.88
R8042:Loxhd1 UTSW 18 77,518,888 (GRCm39) missense probably damaging 0.99
R8084:Loxhd1 UTSW 18 77,427,845 (GRCm39) missense possibly damaging 0.71
R8088:Loxhd1 UTSW 18 77,429,709 (GRCm39) missense possibly damaging 0.52
R8100:Loxhd1 UTSW 18 77,492,512 (GRCm39) missense possibly damaging 0.69
R8139:Loxhd1 UTSW 18 77,468,192 (GRCm39) missense possibly damaging 0.95
R8152:Loxhd1 UTSW 18 77,476,095 (GRCm39) missense possibly damaging 0.62
R8199:Loxhd1 UTSW 18 77,469,334 (GRCm39) missense possibly damaging 0.77
R8246:Loxhd1 UTSW 18 77,451,242 (GRCm39) missense possibly damaging 0.71
R8263:Loxhd1 UTSW 18 77,462,858 (GRCm39) missense probably damaging 1.00
R8324:Loxhd1 UTSW 18 77,427,275 (GRCm39) critical splice donor site probably null
R8342:Loxhd1 UTSW 18 77,493,681 (GRCm39) missense possibly damaging 0.88
R8401:Loxhd1 UTSW 18 77,468,156 (GRCm39) missense probably damaging 1.00
R8480:Loxhd1 UTSW 18 77,518,827 (GRCm39) missense probably damaging 1.00
R8490:Loxhd1 UTSW 18 77,529,162 (GRCm39) missense possibly damaging 0.96
R8807:Loxhd1 UTSW 18 77,444,468 (GRCm39) missense possibly damaging 0.93
R8961:Loxhd1 UTSW 18 77,472,765 (GRCm39) missense probably damaging 1.00
R8974:Loxhd1 UTSW 18 77,518,899 (GRCm39) missense possibly damaging 0.88
R9079:Loxhd1 UTSW 18 77,490,593 (GRCm39) missense probably benign
R9284:Loxhd1 UTSW 18 77,501,826 (GRCm39) missense probably damaging 0.97
R9312:Loxhd1 UTSW 18 77,498,285 (GRCm39) missense probably benign 0.05
R9619:Loxhd1 UTSW 18 77,443,871 (GRCm39) missense probably benign 0.32
X0020:Loxhd1 UTSW 18 77,427,258 (GRCm39) nonsense probably null
X0024:Loxhd1 UTSW 18 77,483,099 (GRCm39) missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77,529,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGAGCCAACCTTGAGTGAC -3'
(R):5'- ATGGCAAATCACAGCACGAG -3'

Sequencing Primer
(F):5'- ATTTCATGGACATCTGTGGGAAAG -3'
(R):5'- CAAATCACAGCACGAGAAGAG -3'
Posted On 2019-10-24