Incidental Mutation 'R0622:Ap1b1'
ID 58739
Institutional Source Beutler Lab
Gene Symbol Ap1b1
Ensembl Gene ENSMUSG00000009090
Gene Name adaptor protein complex AP-1, beta 1 subunit
Synonyms Adtb1, beta-prime adaptin, b2b1660Clo
MMRRC Submission 038811-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.753) question?
Stock # R0622 (G1)
Quality Score 161
Status Not validated
Chromosome 11
Chromosomal Location 4936824-4992791 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4987707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 744 (M744V)
Ref Sequence ENSEMBL: ENSMUSP00000009234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009234] [ENSMUST00000101613] [ENSMUST00000109897]
AlphaFold O35643
Predicted Effect probably damaging
Transcript: ENSMUST00000009234
AA Change: M744V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000009234
Gene: ENSMUSG00000009090
AA Change: M744V

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 1.5e-174 PFAM
Pfam:HEAT_2 88 157 3.2e-8 PFAM
Pfam:Cnd1 99 268 4.1e-41 PFAM
low complexity region 594 616 N/A INTRINSIC
low complexity region 626 638 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 674 686 N/A INTRINSIC
Alpha_adaptinC2 713 823 3.38e-18 SMART
B2-adapt-app_C 832 942 4.6e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101613
AA Change: M724V

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099134
Gene: ENSMUSG00000009090
AA Change: M724V

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 7.5e-61 PFAM
Pfam:HEAT_2 88 179 2e-9 PFAM
Pfam:Cnd1 99 176 2.4e-19 PFAM
Pfam:Cnd1 174 241 1.9e-10 PFAM
Pfam:Adaptin_N 176 507 3.8e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 654 666 N/A INTRINSIC
Alpha_adaptinC2 693 803 3.38e-18 SMART
B2-adapt-app_C 812 922 4.6e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109897
AA Change: M717V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105523
Gene: ENSMUSG00000009090
AA Change: M717V

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 1.2e-60 PFAM
Pfam:HEAT_2 88 185 3.9e-10 PFAM
Pfam:Cnd1 99 175 5e-20 PFAM
Pfam:Cnd1 174 241 1.7e-7 PFAM
Pfam:Adaptin_N 176 507 4.9e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
Alpha_adaptinC2 686 796 3.38e-18 SMART
B2-adapt-app_C 805 915 4.6e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197692
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,565,664 (GRCm39) M243K probably benign Het
Ccdc152 T C 15: 3,327,660 (GRCm39) N39S probably damaging Het
Cd163 G A 6: 124,294,311 (GRCm39) V490M probably damaging Het
Col6a5 G T 9: 105,803,051 (GRCm39) H1305N unknown Het
Cpb1 C A 3: 20,303,982 (GRCm39) D361Y probably damaging Het
Dchs1 T A 7: 105,412,656 (GRCm39) Y1248F probably damaging Het
Dhdds G C 4: 133,721,547 (GRCm39) F83L probably damaging Het
Dsg4 T A 18: 20,582,845 (GRCm39) V161E possibly damaging Het
Exosc4 A G 15: 76,211,736 (GRCm39) D15G probably damaging Het
F3 A T 3: 121,518,668 (GRCm39) D44V probably damaging Het
Fat2 A T 11: 55,173,954 (GRCm39) F2253Y probably damaging Het
Fbn1 T C 2: 125,220,944 (GRCm39) D650G possibly damaging Het
Gramd4 T A 15: 85,975,590 (GRCm39) F36I probably damaging Het
Grm7 G A 6: 111,335,457 (GRCm39) A623T probably damaging Het
Gys1 A T 7: 45,089,419 (GRCm39) T193S probably damaging Het
Hectd4 A G 5: 121,486,688 (GRCm39) T3228A possibly damaging Het
Itpk1 G T 12: 102,540,239 (GRCm39) D281E probably damaging Het
Kcnh7 A C 2: 62,667,633 (GRCm39) probably null Het
Klhl29 A G 12: 5,131,224 (GRCm39) L852P probably damaging Het
Lrch1 T C 14: 75,033,491 (GRCm39) Y509C probably benign Het
Lrp1b A G 2: 41,618,563 (GRCm39) probably null Het
Mcpt4 C A 14: 56,298,119 (GRCm39) R144L probably benign Het
Mia2 C T 12: 59,178,364 (GRCm39) R12W probably damaging Het
Mrps5 A G 2: 127,436,451 (GRCm39) K116R probably benign Het
Myrf G A 19: 10,200,816 (GRCm39) P286S probably damaging Het
Nanp A G 2: 150,881,164 (GRCm39) M28T probably benign Het
Neb T C 2: 52,102,963 (GRCm39) I4472V probably benign Het
Nfix A C 8: 85,453,111 (GRCm39) N314K probably damaging Het
Nlrc3 C T 16: 3,771,832 (GRCm39) R849Q probably benign Het
Nup210l G A 3: 90,075,047 (GRCm39) V786M probably damaging Het
Or2t44 T C 11: 58,677,167 (GRCm39) S36P probably damaging Het
Or52ad1 A G 7: 102,996,064 (GRCm39) S24P probably damaging Het
Or6z5 T C 7: 6,477,598 (GRCm39) I163T possibly damaging Het
Or8c20 A G 9: 38,260,667 (GRCm39) N96S possibly damaging Het
Pdia4 A T 6: 47,783,452 (GRCm39) F197Y probably damaging Het
Phldb1 T C 9: 44,627,149 (GRCm39) D432G probably damaging Het
Pik3ca A G 3: 32,490,701 (GRCm39) E116G probably damaging Het
Polq T C 16: 36,881,355 (GRCm39) V1173A probably benign Het
Pou2f3 C T 9: 43,036,414 (GRCm39) R423H probably damaging Het
Pramel29 T C 4: 143,939,583 (GRCm39) probably benign Het
Prkag2 T C 5: 25,074,247 (GRCm39) N246S probably damaging Het
Proser1 A G 3: 53,385,281 (GRCm39) S388G probably benign Het
Ralgps1 G A 2: 33,064,459 (GRCm39) R238* probably null Het
Rfx2 T C 17: 57,084,071 (GRCm39) D657G probably damaging Het
Ryr3 A G 2: 112,492,900 (GRCm39) F3724S probably damaging Het
Sh2d5 T C 4: 137,986,539 (GRCm39) S421P probably damaging Het
Slc34a1 C A 13: 23,996,594 (GRCm39) T33K probably damaging Het
St8sia5 A G 18: 77,333,809 (GRCm39) T156A probably damaging Het
Stk32c T C 7: 138,768,026 (GRCm39) D85G probably benign Het
Tnks A G 8: 35,407,976 (GRCm39) S251P probably damaging Het
Tnxb T A 17: 34,937,703 (GRCm39) L3864Q probably damaging Het
Trim9 A G 12: 70,393,378 (GRCm39) Y189H probably damaging Het
Vmn1r77 T G 7: 11,775,315 (GRCm39) F30L probably benign Het
Wasf3 A G 5: 146,403,602 (GRCm39) probably null Het
Wdr90 C T 17: 26,074,632 (GRCm39) C603Y probably damaging Het
Zdhhc25 T C 15: 88,485,310 (GRCm39) L215P probably damaging Het
Zeb1 C T 18: 5,759,123 (GRCm39) Q140* probably null Het
Zfp677 C T 17: 21,617,962 (GRCm39) L340F probably benign Het
Other mutations in Ap1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Ap1b1 APN 11 4,969,433 (GRCm39) missense probably damaging 1.00
IGL01843:Ap1b1 APN 11 4,989,169 (GRCm39) missense probably damaging 1.00
IGL01981:Ap1b1 APN 11 4,969,336 (GRCm39) missense possibly damaging 0.84
IGL02055:Ap1b1 APN 11 4,974,452 (GRCm39) nonsense probably null
IGL02318:Ap1b1 APN 11 4,969,294 (GRCm39) missense probably benign 0.14
IGL02505:Ap1b1 APN 11 4,981,700 (GRCm39) missense probably benign 0.11
IGL02824:Ap1b1 APN 11 4,983,738 (GRCm39) missense possibly damaging 0.47
IGL02825:Ap1b1 APN 11 4,983,738 (GRCm39) missense possibly damaging 0.47
IGL02963:Ap1b1 APN 11 4,983,738 (GRCm39) missense possibly damaging 0.47
PIT4142001:Ap1b1 UTSW 11 4,990,360 (GRCm39) missense probably damaging 1.00
R0321:Ap1b1 UTSW 11 4,982,464 (GRCm39) missense probably benign
R0477:Ap1b1 UTSW 11 4,981,787 (GRCm39) missense probably benign 0.13
R0831:Ap1b1 UTSW 11 4,973,092 (GRCm39) splice site probably benign
R1502:Ap1b1 UTSW 11 4,990,290 (GRCm39) missense probably benign
R1529:Ap1b1 UTSW 11 4,989,547 (GRCm39) missense probably damaging 1.00
R2110:Ap1b1 UTSW 11 4,965,613 (GRCm39) missense probably damaging 0.99
R2112:Ap1b1 UTSW 11 4,965,613 (GRCm39) missense probably damaging 0.99
R2186:Ap1b1 UTSW 11 4,965,737 (GRCm39) missense possibly damaging 0.84
R2906:Ap1b1 UTSW 11 4,981,641 (GRCm39) missense probably damaging 1.00
R2907:Ap1b1 UTSW 11 4,981,641 (GRCm39) missense probably damaging 1.00
R2908:Ap1b1 UTSW 11 4,981,641 (GRCm39) missense probably damaging 1.00
R3154:Ap1b1 UTSW 11 4,973,135 (GRCm39) missense possibly damaging 0.95
R3611:Ap1b1 UTSW 11 4,974,427 (GRCm39) missense possibly damaging 0.87
R3805:Ap1b1 UTSW 11 4,983,225 (GRCm39) splice site probably null
R4207:Ap1b1 UTSW 11 4,981,637 (GRCm39) missense probably damaging 0.96
R4660:Ap1b1 UTSW 11 4,966,760 (GRCm39) missense probably damaging 1.00
R4710:Ap1b1 UTSW 11 4,981,664 (GRCm39) missense probably damaging 0.97
R4826:Ap1b1 UTSW 11 4,968,043 (GRCm39) missense probably benign 0.11
R4914:Ap1b1 UTSW 11 4,974,400 (GRCm39) missense possibly damaging 0.73
R5086:Ap1b1 UTSW 11 4,968,020 (GRCm39) missense possibly damaging 0.83
R5249:Ap1b1 UTSW 11 4,976,364 (GRCm39) missense probably damaging 0.97
R6014:Ap1b1 UTSW 11 4,969,364 (GRCm39) missense possibly damaging 0.55
R6268:Ap1b1 UTSW 11 4,969,493 (GRCm39) missense probably damaging 1.00
R6388:Ap1b1 UTSW 11 4,976,319 (GRCm39) missense probably damaging 1.00
R6765:Ap1b1 UTSW 11 4,969,427 (GRCm39) missense probably damaging 1.00
R6913:Ap1b1 UTSW 11 4,962,972 (GRCm39) missense possibly damaging 0.84
R7012:Ap1b1 UTSW 11 4,980,963 (GRCm39) missense probably damaging 1.00
R7107:Ap1b1 UTSW 11 4,989,558 (GRCm39) missense probably benign 0.02
R8291:Ap1b1 UTSW 11 4,968,027 (GRCm39) missense probably damaging 1.00
R9075:Ap1b1 UTSW 11 4,975,597 (GRCm39) missense possibly damaging 0.93
R9090:Ap1b1 UTSW 11 4,973,174 (GRCm39) missense probably damaging 1.00
R9271:Ap1b1 UTSW 11 4,973,174 (GRCm39) missense probably damaging 1.00
R9297:Ap1b1 UTSW 11 4,990,157 (GRCm39) missense probably benign 0.05
R9318:Ap1b1 UTSW 11 4,990,157 (GRCm39) missense probably benign 0.05
R9560:Ap1b1 UTSW 11 4,976,363 (GRCm39) missense probably benign 0.38
X0018:Ap1b1 UTSW 11 4,959,581 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGGGGTCACCTATCTTCATC -3'
(R):5'- TAAGGCACTTCCAGTGGTAGGCAG -3'

Sequencing Primer
(F):5'- CTCAGCTACTCTGATAGACGG -3'
(R):5'- CAAAACTATCCTTTGGGCAGTGG -3'
Posted On 2013-07-11