Incidental Mutation 'R7591:Cldn11'
ID 587392
Institutional Source Beutler Lab
Gene Symbol Cldn11
Ensembl Gene ENSMUSG00000037625
Gene Name claudin 11
Synonyms Otm, Osp, oligodendrocyte-specific protein
MMRRC Submission 045638-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R7591 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 31204069-31218473 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31204436 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 46 (E46D)
Ref Sequence ENSEMBL: ENSMUSP00000042181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046174]
AlphaFold Q60771
Predicted Effect probably benign
Transcript: ENSMUST00000046174
AA Change: E46D

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042181
Gene: ENSMUSG00000037625
AA Change: E46D

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 175 2.6e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a major component of CNS (central nervous system) myelin and plays an important role in regulating proliferation and migration of oligodendrocytes. The basal cell tight junctions in stria vascularis are primarily composed of this protein, and the gene-null mice suffer severe deafness. This protein is also an obligatory protein for tight junction formation and barrier integrity in the testis and the gene deficiency results in loss of the Sertoli cell epithelial phenotype in the testis. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygous null mice exhibit tremors, impaired coordination, hindlimb weakness, abnormal myelination of the cranial nerves, increased auditory thresholds, and abnormal stria vascularis. Mutant males have small testes, abnormal seminiferous tubules, and sperm abnormalities resulting in infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccne2 T C 4: 11,201,393 (GRCm39) I307T probably benign Het
Chrm3 A T 13: 9,927,349 (GRCm39) C562* probably null Het
Cyp4a14 A G 4: 115,347,157 (GRCm39) probably null Het
Dbh A G 2: 27,060,522 (GRCm39) T233A probably damaging Het
Dennd2c T A 3: 103,040,661 (GRCm39) Y309N possibly damaging Het
Dnttip2 T A 3: 122,070,117 (GRCm39) L444* probably null Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Epop A T 11: 97,519,158 (GRCm39) V317E probably damaging Het
Eppk1 T C 15: 75,991,797 (GRCm39) T1695A possibly damaging Het
Fam149a T A 8: 45,803,472 (GRCm39) I421F possibly damaging Het
Impa2 T C 18: 67,451,480 (GRCm39) L258P probably damaging Het
Itga1 G A 13: 115,119,315 (GRCm39) R855W probably damaging Het
Kcnh5 T C 12: 75,054,541 (GRCm39) T468A probably benign Het
Kif11 A G 19: 37,372,711 (GRCm39) K33R probably damaging Het
Lamb1 C A 12: 31,376,647 (GRCm39) A1657E probably damaging Het
Macc1 T C 12: 119,410,393 (GRCm39) V387A probably damaging Het
Nalcn T C 14: 123,561,297 (GRCm39) T734A probably benign Het
Nphp3 T C 9: 103,895,477 (GRCm39) probably null Het
Nutm2 A G 13: 50,627,903 (GRCm39) I461M probably damaging Het
Or14p1 T C 13: 65,292,462 (GRCm39) F130L probably benign Het
Or4p7 G A 2: 88,222,220 (GRCm39) V210M probably benign Het
Or4s2 A C 2: 88,473,811 (GRCm39) K233N probably damaging Het
Or5b112 A G 19: 13,319,619 (GRCm39) S166G probably benign Het
Pigo T C 4: 43,025,093 (GRCm39) N2S probably benign Het
Plcl1 A T 1: 55,736,608 (GRCm39) I650L probably benign Het
Ppcdc A T 9: 57,342,262 (GRCm39) V20D probably damaging Het
Pramel27 A T 4: 143,577,481 (GRCm39) I88L probably benign Het
Rhobtb2 A G 14: 70,037,190 (GRCm39) V78A possibly damaging Het
Rp1l1 T C 14: 64,263,558 (GRCm39) V226A probably damaging Het
Scrt1 C A 15: 76,403,694 (GRCm39) G99C probably damaging Het
Skint9 A T 4: 112,248,147 (GRCm39) I199N probably damaging Het
Slc5a4a T C 10: 75,983,501 (GRCm39) probably benign Het
Smad3 C T 9: 63,561,999 (GRCm39) W326* probably null Het
Spata18 A T 5: 73,829,759 (GRCm39) I305F Het
Spata31h1 C A 10: 82,128,046 (GRCm39) V1655F probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Syne3 A G 12: 104,906,863 (GRCm39) probably null Het
Trim69 G A 2: 121,998,454 (GRCm39) R142Q probably benign Het
Vmn1r40 A T 6: 89,691,755 (GRCm39) I191F probably benign Het
Vmn2r16 T A 5: 109,510,223 (GRCm39) D535E probably damaging Het
Vwa5b2 A G 16: 20,420,317 (GRCm39) E742G probably damaging Het
Zfp442 A T 2: 150,250,092 (GRCm39) Y603* probably null Het
Zp1 T C 19: 10,896,835 (GRCm39) N68S probably damaging Het
Other mutations in Cldn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02123:Cldn11 APN 3 31,204,336 (GRCm39) missense probably benign 0.01
IGL02403:Cldn11 APN 3 31,204,345 (GRCm39) missense probably benign 0.00
IGL03047:Cldn11 UTSW 3 31,217,256 (GRCm39) missense probably damaging 1.00
R2122:Cldn11 UTSW 3 31,217,300 (GRCm39) missense probably damaging 1.00
R4082:Cldn11 UTSW 3 31,217,278 (GRCm39) missense probably benign 0.00
R5589:Cldn11 UTSW 3 31,204,395 (GRCm39) missense probably damaging 0.96
R8174:Cldn11 UTSW 3 31,208,210 (GRCm39) missense probably benign 0.12
R8357:Cldn11 UTSW 3 31,217,342 (GRCm39) missense probably benign 0.10
R8457:Cldn11 UTSW 3 31,217,342 (GRCm39) missense probably benign 0.10
R8694:Cldn11 UTSW 3 31,217,239 (GRCm39) missense probably damaging 1.00
R9098:Cldn11 UTSW 3 31,217,276 (GRCm39) missense probably damaging 1.00
R9376:Cldn11 UTSW 3 31,217,410 (GRCm39) missense possibly damaging 0.69
Z1176:Cldn11 UTSW 3 31,204,455 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCGTGTGAGTCGAGCTG -3'
(R):5'- CTCCTACAGGGTTGGATTGG -3'

Sequencing Primer
(F):5'- TGAGTCGAGCTGCGTGGAC -3'
(R):5'- GAGGTCTCTGAGTCTCCAAAC -3'
Posted On 2019-10-24