Incidental Mutation 'R7591:Cyp4a14'
ID 587398
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 045638-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7591 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 115347157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably null
Transcript: ENSMUST00000030487
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Meta Mutation Damage Score 0.9475 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccne2 T C 4: 11,201,393 (GRCm39) I307T probably benign Het
Chrm3 A T 13: 9,927,349 (GRCm39) C562* probably null Het
Cldn11 A T 3: 31,204,436 (GRCm39) E46D probably benign Het
Dbh A G 2: 27,060,522 (GRCm39) T233A probably damaging Het
Dennd2c T A 3: 103,040,661 (GRCm39) Y309N possibly damaging Het
Dnttip2 T A 3: 122,070,117 (GRCm39) L444* probably null Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Epop A T 11: 97,519,158 (GRCm39) V317E probably damaging Het
Eppk1 T C 15: 75,991,797 (GRCm39) T1695A possibly damaging Het
Fam149a T A 8: 45,803,472 (GRCm39) I421F possibly damaging Het
Impa2 T C 18: 67,451,480 (GRCm39) L258P probably damaging Het
Itga1 G A 13: 115,119,315 (GRCm39) R855W probably damaging Het
Kcnh5 T C 12: 75,054,541 (GRCm39) T468A probably benign Het
Kif11 A G 19: 37,372,711 (GRCm39) K33R probably damaging Het
Lamb1 C A 12: 31,376,647 (GRCm39) A1657E probably damaging Het
Macc1 T C 12: 119,410,393 (GRCm39) V387A probably damaging Het
Nalcn T C 14: 123,561,297 (GRCm39) T734A probably benign Het
Nphp3 T C 9: 103,895,477 (GRCm39) probably null Het
Nutm2 A G 13: 50,627,903 (GRCm39) I461M probably damaging Het
Or14p1 T C 13: 65,292,462 (GRCm39) F130L probably benign Het
Or4p7 G A 2: 88,222,220 (GRCm39) V210M probably benign Het
Or4s2 A C 2: 88,473,811 (GRCm39) K233N probably damaging Het
Or5b112 A G 19: 13,319,619 (GRCm39) S166G probably benign Het
Pigo T C 4: 43,025,093 (GRCm39) N2S probably benign Het
Plcl1 A T 1: 55,736,608 (GRCm39) I650L probably benign Het
Ppcdc A T 9: 57,342,262 (GRCm39) V20D probably damaging Het
Pramel27 A T 4: 143,577,481 (GRCm39) I88L probably benign Het
Rhobtb2 A G 14: 70,037,190 (GRCm39) V78A possibly damaging Het
Rp1l1 T C 14: 64,263,558 (GRCm39) V226A probably damaging Het
Scrt1 C A 15: 76,403,694 (GRCm39) G99C probably damaging Het
Skint9 A T 4: 112,248,147 (GRCm39) I199N probably damaging Het
Slc5a4a T C 10: 75,983,501 (GRCm39) probably benign Het
Smad3 C T 9: 63,561,999 (GRCm39) W326* probably null Het
Spata18 A T 5: 73,829,759 (GRCm39) I305F Het
Spata31h1 C A 10: 82,128,046 (GRCm39) V1655F probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Syne3 A G 12: 104,906,863 (GRCm39) probably null Het
Trim69 G A 2: 121,998,454 (GRCm39) R142Q probably benign Het
Vmn1r40 A T 6: 89,691,755 (GRCm39) I191F probably benign Het
Vmn2r16 T A 5: 109,510,223 (GRCm39) D535E probably damaging Het
Vwa5b2 A G 16: 20,420,317 (GRCm39) E742G probably damaging Het
Zfp442 A T 2: 150,250,092 (GRCm39) Y603* probably null Het
Zp1 T C 19: 10,896,835 (GRCm39) N68S probably damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGATCCTCCTGAGAATGGCAG -3'
(R):5'- TGCTGTCTGTTATCACCAGGC -3'

Sequencing Primer
(F):5'- TCCTCCTGAGAATGGCAGATAAGC -3'
(R):5'- GGACCATTAGCTCTACATGATGACTC -3'
Posted On 2019-10-24