Incidental Mutation 'R7591:Nutm2'
ID587415
Institutional Source Beutler Lab
Gene Symbol Nutm2
Ensembl Gene ENSMUSG00000071909
Gene NameNUT family member 2
SynonymsLOC328250, Gm806
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7591 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location50467307-50475355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50473867 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 461 (I461M)
Ref Sequence ENSEMBL: ENSMUSP00000094390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096633]
Predicted Effect probably damaging
Transcript: ENSMUST00000096633
AA Change: I461M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094390
Gene: ENSMUSG00000071909
AA Change: I461M

DomainStartEndE-ValueType
Pfam:NUT 27 733 9e-277 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C A 10: 82,292,212 V1655F probably benign Het
Ccne2 T C 4: 11,201,393 I307T probably benign Het
Chrm3 A T 13: 9,877,313 C562* probably null Het
Cldn11 A T 3: 31,150,287 E46D probably benign Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dbh A G 2: 27,170,510 T233A probably damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnttip2 T A 3: 122,276,468 L444* probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epop A T 11: 97,628,332 V317E probably damaging Het
Eppk1 T C 15: 76,107,597 T1695A possibly damaging Het
Fam149a T A 8: 45,350,435 I421F possibly damaging Het
Gm13103 A T 4: 143,850,911 I88L probably benign Het
Impa2 T C 18: 67,318,410 L258P probably damaging Het
Itga1 G A 13: 114,982,779 R855W probably damaging Het
Kcnh5 T C 12: 75,007,767 T468A probably benign Het
Kif11 A G 19: 37,384,263 K33R probably damaging Het
Lamb1 C A 12: 31,326,648 A1657E probably damaging Het
Macc1 T C 12: 119,446,658 V387A probably damaging Het
Nalcn T C 14: 123,323,885 T734A probably benign Het
Nphp3 T C 9: 104,018,278 probably null Het
Olfr1178 G A 2: 88,391,876 V210M probably benign Het
Olfr1191-ps1 A C 2: 88,643,467 K233N probably damaging Het
Olfr1466 A G 19: 13,342,255 S166G probably benign Het
Olfr465-ps1 T C 13: 65,144,648 F130L probably benign Het
Pigo T C 4: 43,025,093 N2S probably benign Het
Plcl1 A T 1: 55,697,449 I650L probably benign Het
Ppcdc A T 9: 57,434,979 V20D probably damaging Het
Rhobtb2 A G 14: 69,799,741 V78A possibly damaging Het
Rp1l1 T C 14: 64,026,109 V226A probably damaging Het
Scrt1 C A 15: 76,519,494 G99C probably damaging Het
Skint9 A T 4: 112,390,950 I199N probably damaging Het
Slc5a4a T C 10: 76,147,667 probably benign Het
Smad3 C T 9: 63,654,717 W326* probably null Het
Spata18 A T 5: 73,672,416 I305F Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syne3 A G 12: 104,940,604 probably null Het
Trim69 G A 2: 122,167,973 R142Q probably benign Het
Vmn1r40 A T 6: 89,714,773 I191F probably benign Het
Vmn2r16 T A 5: 109,362,357 D535E probably damaging Het
Vwa5b2 A G 16: 20,601,567 E742G probably damaging Het
Zfp442 A T 2: 150,408,172 Y603* probably null Het
Zp1 T C 19: 10,919,471 N68S probably damaging Het
Other mutations in Nutm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nutm2 APN 13 50474860 missense probably benign 0.18
IGL01087:Nutm2 APN 13 50469629 missense probably damaging 1.00
IGL01707:Nutm2 APN 13 50469717 missense probably damaging 0.96
IGL02085:Nutm2 APN 13 50473793 splice site probably null
IGL02238:Nutm2 APN 13 50471039 missense probably damaging 1.00
IGL02369:Nutm2 APN 13 50469908 missense probably benign 0.16
IGL02429:Nutm2 APN 13 50469480 missense probably benign 0.44
IGL03083:Nutm2 APN 13 50467444 missense probably damaging 0.98
R0233:Nutm2 UTSW 13 50467405 missense probably benign 0.41
R0233:Nutm2 UTSW 13 50467405 missense probably benign 0.41
R0321:Nutm2 UTSW 13 50472955 missense probably damaging 0.98
R1481:Nutm2 UTSW 13 50469481 missense probably damaging 0.99
R1605:Nutm2 UTSW 13 50469919 missense possibly damaging 0.68
R1679:Nutm2 UTSW 13 50469386 missense probably benign 0.17
R1744:Nutm2 UTSW 13 50469354 missense probably benign 0.03
R1768:Nutm2 UTSW 13 50473116 missense probably damaging 1.00
R1969:Nutm2 UTSW 13 50473842 missense probably damaging 1.00
R2026:Nutm2 UTSW 13 50474820 missense probably benign 0.00
R2187:Nutm2 UTSW 13 50467417 missense probably benign 0.00
R3912:Nutm2 UTSW 13 50472940 missense possibly damaging 0.92
R4025:Nutm2 UTSW 13 50469353 missense probably benign
R4367:Nutm2 UTSW 13 50469884 missense probably benign 0.01
R4668:Nutm2 UTSW 13 50472997 missense probably benign 0.18
R4940:Nutm2 UTSW 13 50474873 missense possibly damaging 0.58
R4987:Nutm2 UTSW 13 50472343 missense possibly damaging 0.93
R4988:Nutm2 UTSW 13 50472343 missense possibly damaging 0.93
R5821:Nutm2 UTSW 13 50469855 missense probably benign 0.01
R5986:Nutm2 UTSW 13 50474460 missense probably damaging 1.00
R6189:Nutm2 UTSW 13 50469738 missense possibly damaging 0.91
R7101:Nutm2 UTSW 13 50472898 missense probably benign 0.00
R7192:Nutm2 UTSW 13 50473069 missense probably damaging 1.00
R7394:Nutm2 UTSW 13 50470007 missense probably damaging 1.00
X0028:Nutm2 UTSW 13 50472954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTGCCATCATGAGTTGTCAC -3'
(R):5'- ATGAGCATGGTCTTCTCCCTG -3'

Sequencing Primer
(F):5'- TGTCACCAACATAGGACAAGATTG -3'
(R):5'- AGTGTCCCACTTCATTTGGAG -3'
Posted On2019-10-24