Mutagenetix > Incidental Mutation

Incidental Mutation 'R7591:Itga1'

587417

Institutional Source

Beutler Lab

Gene Symbol

Itga1

Ensembl Gene

ENSMUSG00000042284

Gene Name

integrin alpha 1

Synonyms

CD49A, Vla1, E130012M19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.384) question?

Stock #

R7591 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114953096-115101964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114982779 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 855 (R855W)

Ref Sequence

ENSEMBL: ENSMUSP00000077132 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061673]

AlphaFold

Q3V3R4

Predicted Effect

probably damaging
Transcript: ENSMUST00000061673
AA Change: R855W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: R855W

Domain	Start	End	E-Value	Type
Int_alpha	43	96	1.63e0	SMART
VWA	170	360	4.24e-44	SMART
Int_alpha	432	481	4.21e-3	SMART
Int_alpha	485	542	3.19e-12	SMART
Int_alpha	566	621	1.79e-15	SMART
Int_alpha	628	682	3.04e1	SMART
low complexity region	1108	1122	N/A	INTRINSIC
PDB:2L8S\|A	1135	1179	5e-10	PDB

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	C	A	10: 82,292,212	V1655F	probably benign	Het
Ccne2	T	C	4: 11,201,393	I307T	probably benign	Het
Chrm3	A	T	13: 9,877,313	C562*	probably null	Het
Cldn11	A	T	3: 31,150,287	E46D	probably benign	Het
Cyp4a14	A	G	4: 115,489,960		probably null	Het
Dbh	A	G	2: 27,170,510	T233A	probably damaging	Het
Dennd2c	T	A	3: 103,133,345	Y309N	possibly damaging	Het
Dnttip2	T	A	3: 122,276,468	L444*	probably null	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epop	A	T	11: 97,628,332	V317E	probably damaging	Het
Eppk1	T	C	15: 76,107,597	T1695A	possibly damaging	Het
Fam149a	T	A	8: 45,350,435	I421F	possibly damaging	Het
Gm13103	A	T	4: 143,850,911	I88L	probably benign	Het
Impa2	T	C	18: 67,318,410	L258P	probably damaging	Het
Kcnh5	T	C	12: 75,007,767	T468A	probably benign	Het
Kif11	A	G	19: 37,384,263	K33R	probably damaging	Het
Lamb1	C	A	12: 31,326,648	A1657E	probably damaging	Het
Macc1	T	C	12: 119,446,658	V387A	probably damaging	Het
Nalcn	T	C	14: 123,323,885	T734A	probably benign	Het
Nphp3	T	C	9: 104,018,278		probably null	Het
Nutm2	A	G	13: 50,473,867	I461M	probably damaging	Het
Olfr1178	G	A	2: 88,391,876	V210M	probably benign	Het
Olfr1191-ps1	A	C	2: 88,643,467	K233N	probably damaging	Het
Olfr1466	A	G	19: 13,342,255	S166G	probably benign	Het
Olfr465-ps1	T	C	13: 65,144,648	F130L	probably benign	Het
Pigo	T	C	4: 43,025,093	N2S	probably benign	Het
Plcl1	A	T	1: 55,697,449	I650L	probably benign	Het
Ppcdc	A	T	9: 57,434,979	V20D	probably damaging	Het
Rhobtb2	A	G	14: 69,799,741	V78A	possibly damaging	Het
Rp1l1	T	C	14: 64,026,109	V226A	probably damaging	Het
Scrt1	C	A	15: 76,519,494	G99C	probably damaging	Het
Skint9	A	T	4: 112,390,950	I199N	probably damaging	Het
Slc5a4a	T	C	10: 76,147,667		probably benign	Het
Smad3	C	T	9: 63,654,717	W326*	probably null	Het
Spata18	A	T	5: 73,672,416	I305F		Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Syne3	A	G	12: 104,940,604		probably null	Het
Trim69	G	A	2: 122,167,973	R142Q	probably benign	Het
Vmn1r40	A	T	6: 89,714,773	I191F	probably benign	Het
Vmn2r16	T	A	5: 109,362,357	D535E	probably damaging	Het
Vwa5b2	A	G	16: 20,601,567	E742G	probably damaging	Het
Zfp442	A	T	2: 150,408,172	Y603*	probably null	Het
Zp1	T	C	19: 10,919,471	N68S	probably damaging	Het

Other mutations in Itga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Itga1	APN	13	114992363	missense	possibly damaging	0.80
IGL00498:Itga1	APN	13	115031193	missense	probably benign	0.00
IGL00549:Itga1	APN	13	115049296	missense	possibly damaging	0.92
IGL00587:Itga1	APN	13	115012249	missense	probably damaging	1.00
IGL01021:Itga1	APN	13	114997000	missense	probably benign	0.29
IGL01289:Itga1	APN	13	114986226	missense	possibly damaging	0.79
IGL01636:Itga1	APN	13	115006948	missense	possibly damaging	0.73
IGL01791:Itga1	APN	13	114987661	missense	probably benign	0.00
IGL01796:Itga1	APN	13	114985121	missense	probably damaging	1.00
IGL02027:Itga1	APN	13	114990055	splice site	probably null
IGL02330:Itga1	APN	13	115012204	missense	probably damaging	1.00
IGL02480:Itga1	APN	13	114987648	missense	probably damaging	1.00
IGL02943:Itga1	APN	13	115049296	missense	possibly damaging	0.92
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0244:Itga1	UTSW	13	115006897	splice site	probably benign
R0265:Itga1	UTSW	13	114992459	missense	probably benign
R0302:Itga1	UTSW	13	115012318	splice site	probably benign
R0320:Itga1	UTSW	13	114977594	splice site	probably benign
R0389:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0443:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0574:Itga1	UTSW	13	114966561	missense	probably damaging	1.00
R0646:Itga1	UTSW	13	114968299	missense	probably benign
R0830:Itga1	UTSW	13	115007032	missense	probably benign	0.08
R2162:Itga1	UTSW	13	115030910	missense	probably benign	0.23
R2216:Itga1	UTSW	13	114997029	missense	probably benign	0.00
R2403:Itga1	UTSW	13	114977614	missense	probably benign	0.00
R3734:Itga1	UTSW	13	114977639	missense	probably benign
R4171:Itga1	UTSW	13	115030886	nonsense	probably null
R4402:Itga1	UTSW	13	115001566	missense	probably benign	0.00
R4675:Itga1	UTSW	13	115001691	splice site	probably null
R4684:Itga1	UTSW	13	115049370	missense	probably damaging	1.00
R4795:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4796:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4845:Itga1	UTSW	13	114974172	nonsense	probably null
R5147:Itga1	UTSW	13	114985142	missense	possibly damaging	0.91
R5155:Itga1	UTSW	13	115035303	missense	probably benign
R5234:Itga1	UTSW	13	115049303	nonsense	probably null
R5344:Itga1	UTSW	13	115002309	missense	possibly damaging	0.78
R5554:Itga1	UTSW	13	114992474	nonsense	probably null
R5662:Itga1	UTSW	13	114986171	missense	probably benign	0.03
R5945:Itga1	UTSW	13	114966590	missense	probably benign	0.02
R6150:Itga1	UTSW	13	114968233	missense	probably benign	0.01
R6241:Itga1	UTSW	13	114960137	splice site	probably null
R6276:Itga1	UTSW	13	114980852	missense	probably benign
R6369:Itga1	UTSW	13	114965660	missense	probably damaging	1.00
R6511:Itga1	UTSW	13	114992501	missense	probably damaging	0.98
R6663:Itga1	UTSW	13	114974105	missense	probably benign	0.02
R6783:Itga1	UTSW	13	114996977	missense	probably benign	0.22
R6931:Itga1	UTSW	13	115001563	missense	probably benign	0.39
R7069:Itga1	UTSW	13	114968240	missense	probably damaging	1.00
R7458:Itga1	UTSW	13	114986266	missense	probably benign	0.00
R7588:Itga1	UTSW	13	114968249	missense	possibly damaging	0.88
R7597:Itga1	UTSW	13	114974140	missense	probably benign	0.28
R7615:Itga1	UTSW	13	114996922	missense	probably null	0.99
R7756:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R7795:Itga1	UTSW	13	115012236	missense	probably damaging	1.00
R7819:Itga1	UTSW	13	115049301	missense	probably damaging	0.99
R8193:Itga1	UTSW	13	114968455	critical splice donor site	probably null
R8313:Itga1	UTSW	13	114966584	missense	probably benign	0.06
R8419:Itga1	UTSW	13	115007068	missense	probably damaging	1.00
R8925:Itga1	UTSW	13	114968519	missense	probably benign	0.01
R8927:Itga1	UTSW	13	114968519	missense	probably benign	0.01
R8951:Itga1	UTSW	13	114970491	nonsense	probably null
R9099:Itga1	UTSW	13	115049320	missense	probably damaging	1.00
R9200:Itga1	UTSW	13	114968461	missense	possibly damaging	0.80
R9221:Itga1	UTSW	13	115030159	nonsense	probably null
R9249:Itga1	UTSW	13	115049298	missense	probably damaging	1.00
R9267:Itga1	UTSW	13	115049388	missense	possibly damaging	0.50
R9376:Itga1	UTSW	13	114970576	missense	probably benign	0.07
R9481:Itga1	UTSW	13	115016217	missense	probably benign	0.34
R9789:Itga1	UTSW	13	115035284	nonsense	probably null
Z1177:Itga1	UTSW	13	114985071	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAACTACAACCACTTGTATGTC -3'
(R):5'- ACCTGAGCTATGAATGCCACG -3'

Sequencing Primer
(F):5'- TGTCCTAATATTAACACAACAGCTC -3'
(R):5'- GAGCTATGAATGCCACGTTCCC -3'

Posted On

2019-10-24