Incidental Mutation 'R7591:Rp1l1'
ID 587418
Institutional Source Beutler Lab
Gene Symbol Rp1l1
Ensembl Gene ENSMUSG00000046049
Gene Name retinitis pigmentosa 1 homolog like 1
Synonyms Dcdc4, Rp1hl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7591 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 63992506-64035025 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64026109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 226 (V226A)
Ref Sequence ENSEMBL: ENSMUSP00000055449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058229]
AlphaFold Q8CGM2
Predicted Effect probably damaging
Transcript: ENSMUST00000058229
AA Change: V226A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: V226A

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
DCX 37 121 1.58e-13 SMART
DCX 155 239 1e-15 SMART
low complexity region 709 728 N/A INTRINSIC
low complexity region 870 884 N/A INTRINSIC
low complexity region 1159 1177 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1612 1618 N/A INTRINSIC
low complexity region 1642 1652 N/A INTRINSIC
Meta Mutation Damage Score 0.5367 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C A 10: 82,292,212 V1655F probably benign Het
Ccne2 T C 4: 11,201,393 I307T probably benign Het
Chrm3 A T 13: 9,877,313 C562* probably null Het
Cldn11 A T 3: 31,150,287 E46D probably benign Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dbh A G 2: 27,170,510 T233A probably damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnttip2 T A 3: 122,276,468 L444* probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epop A T 11: 97,628,332 V317E probably damaging Het
Eppk1 T C 15: 76,107,597 T1695A possibly damaging Het
Fam149a T A 8: 45,350,435 I421F possibly damaging Het
Gm13103 A T 4: 143,850,911 I88L probably benign Het
Impa2 T C 18: 67,318,410 L258P probably damaging Het
Itga1 G A 13: 114,982,779 R855W probably damaging Het
Kcnh5 T C 12: 75,007,767 T468A probably benign Het
Kif11 A G 19: 37,384,263 K33R probably damaging Het
Lamb1 C A 12: 31,326,648 A1657E probably damaging Het
Macc1 T C 12: 119,446,658 V387A probably damaging Het
Nalcn T C 14: 123,323,885 T734A probably benign Het
Nphp3 T C 9: 104,018,278 probably null Het
Nutm2 A G 13: 50,473,867 I461M probably damaging Het
Olfr1178 G A 2: 88,391,876 V210M probably benign Het
Olfr1191-ps1 A C 2: 88,643,467 K233N probably damaging Het
Olfr1466 A G 19: 13,342,255 S166G probably benign Het
Olfr465-ps1 T C 13: 65,144,648 F130L probably benign Het
Pigo T C 4: 43,025,093 N2S probably benign Het
Plcl1 A T 1: 55,697,449 I650L probably benign Het
Ppcdc A T 9: 57,434,979 V20D probably damaging Het
Rhobtb2 A G 14: 69,799,741 V78A possibly damaging Het
Scrt1 C A 15: 76,519,494 G99C probably damaging Het
Skint9 A T 4: 112,390,950 I199N probably damaging Het
Slc5a4a T C 10: 76,147,667 probably benign Het
Smad3 C T 9: 63,654,717 W326* probably null Het
Spata18 A T 5: 73,672,416 I305F Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syne3 A G 12: 104,940,604 probably null Het
Trim69 G A 2: 122,167,973 R142Q probably benign Het
Vmn1r40 A T 6: 89,714,773 I191F probably benign Het
Vmn2r16 T A 5: 109,362,357 D535E probably damaging Het
Vwa5b2 A G 16: 20,601,567 E742G probably damaging Het
Zfp442 A T 2: 150,408,172 Y603* probably null Het
Zp1 T C 19: 10,919,471 N68S probably damaging Het
Other mutations in Rp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rp1l1 APN 14 64028725 missense probably benign 0.01
IGL02063:Rp1l1 APN 14 64029536 missense probably damaging 0.99
IGL02132:Rp1l1 APN 14 64028810 missense probably benign
IGL02430:Rp1l1 APN 14 64029286 missense probably benign 0.00
IGL02977:Rp1l1 APN 14 64028150 missense probably benign 0.01
IGL03213:Rp1l1 APN 14 64028415 missense probably damaging 0.98
IGL03346:Rp1l1 APN 14 64029440 missense probably benign
R0085:Rp1l1 UTSW 14 64022295 missense probably damaging 0.99
R0347:Rp1l1 UTSW 14 64030804 nonsense probably null
R0362:Rp1l1 UTSW 14 64031066 nonsense probably null
R0369:Rp1l1 UTSW 14 64029388 missense possibly damaging 0.84
R0538:Rp1l1 UTSW 14 64022092 missense probably damaging 1.00
R0544:Rp1l1 UTSW 14 64032066 missense probably benign 0.00
R0780:Rp1l1 UTSW 14 64030351 missense possibly damaging 0.94
R0944:Rp1l1 UTSW 14 64032232 missense probably benign 0.05
R1051:Rp1l1 UTSW 14 64032535 missense probably damaging 0.99
R1126:Rp1l1 UTSW 14 64030469 missense probably damaging 1.00
R1450:Rp1l1 UTSW 14 64028150 missense probably benign 0.01
R1483:Rp1l1 UTSW 14 64029047 missense possibly damaging 0.76
R1508:Rp1l1 UTSW 14 64030892 missense possibly damaging 0.83
R1553:Rp1l1 UTSW 14 64031894 missense probably benign 0.00
R1651:Rp1l1 UTSW 14 64030993 missense probably damaging 0.97
R1682:Rp1l1 UTSW 14 64028968 missense probably damaging 0.98
R1809:Rp1l1 UTSW 14 64027966 missense probably benign 0.18
R1885:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1887:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1898:Rp1l1 UTSW 14 64031590 missense probably benign 0.04
R1924:Rp1l1 UTSW 14 64031543 missense probably benign
R1939:Rp1l1 UTSW 14 64029593 missense probably benign
R1941:Rp1l1 UTSW 14 64022252 missense probably damaging 1.00
R2129:Rp1l1 UTSW 14 64028966 missense possibly damaging 0.93
R2363:Rp1l1 UTSW 14 64029998 missense possibly damaging 0.55
R3894:Rp1l1 UTSW 14 64029307 missense probably benign
R3974:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3975:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3976:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R4072:Rp1l1 UTSW 14 64028132 missense probably damaging 1.00
R4672:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4673:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4749:Rp1l1 UTSW 14 64029800 missense probably damaging 0.99
R4755:Rp1l1 UTSW 14 64030070 missense probably benign 0.34
R4877:Rp1l1 UTSW 14 64026171 missense probably benign 0.00
R4930:Rp1l1 UTSW 14 64032206 missense probably benign
R5039:Rp1l1 UTSW 14 64031356 missense probably benign 0.21
R5106:Rp1l1 UTSW 14 64027946 missense probably damaging 1.00
R5184:Rp1l1 UTSW 14 64030180 missense probably damaging 1.00
R5215:Rp1l1 UTSW 14 64030013 missense probably benign 0.01
R5409:Rp1l1 UTSW 14 64030621 missense probably benign 0.02
R5575:Rp1l1 UTSW 14 64030984 missense probably benign 0.23
R5696:Rp1l1 UTSW 14 64029746 missense probably damaging 0.99
R5739:Rp1l1 UTSW 14 64032170 missense probably benign 0.01
R5878:Rp1l1 UTSW 14 64028906 missense probably benign 0.09
R6133:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6134:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6135:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6428:Rp1l1 UTSW 14 64032389 missense possibly damaging 0.92
R6594:Rp1l1 UTSW 14 64031677 nonsense probably null
R6736:Rp1l1 UTSW 14 64029724 missense possibly damaging 0.93
R6800:Rp1l1 UTSW 14 64031150 missense possibly damaging 0.92
R6848:Rp1l1 UTSW 14 64028218 missense possibly damaging 0.79
R6878:Rp1l1 UTSW 14 64031852 missense probably benign 0.00
R6922:Rp1l1 UTSW 14 64030385 missense possibly damaging 0.93
R6980:Rp1l1 UTSW 14 64028720 missense probably benign 0.02
R7053:Rp1l1 UTSW 14 64031509 missense possibly damaging 0.68
R7151:Rp1l1 UTSW 14 64029026 missense possibly damaging 0.73
R7291:Rp1l1 UTSW 14 64032298 missense probably benign 0.10
R7335:Rp1l1 UTSW 14 64031998 missense probably benign 0.00
R7344:Rp1l1 UTSW 14 64029620 missense probably benign 0.00
R7470:Rp1l1 UTSW 14 64028566 missense probably benign
R7570:Rp1l1 UTSW 14 64031574 nonsense probably null
R7585:Rp1l1 UTSW 14 64030139 missense probably damaging 0.96
R7667:Rp1l1 UTSW 14 64029803 missense probably benign 0.04
R7862:Rp1l1 UTSW 14 64028027 missense probably damaging 1.00
R7935:Rp1l1 UTSW 14 64031225 missense probably damaging 0.99
R8256:Rp1l1 UTSW 14 64028153 missense probably benign 0.18
R8403:Rp1l1 UTSW 14 64028809 missense probably benign 0.21
R8709:Rp1l1 UTSW 14 64031846 missense probably damaging 0.98
R8817:Rp1l1 UTSW 14 64030636 missense probably benign
R8971:Rp1l1 UTSW 14 64021996 missense probably damaging 1.00
R9380:Rp1l1 UTSW 14 64029026 missense probably benign 0.29
R9438:Rp1l1 UTSW 14 64028125 missense possibly damaging 0.90
R9501:Rp1l1 UTSW 14 64028590 missense probably benign 0.00
R9652:Rp1l1 UTSW 14 64032265 missense probably damaging 1.00
R9683:Rp1l1 UTSW 14 64031677 missense probably damaging 0.97
X0057:Rp1l1 UTSW 14 64030040 missense probably benign 0.14
X0063:Rp1l1 UTSW 14 64029223 missense probably damaging 0.98
Z1088:Rp1l1 UTSW 14 64028758 missense possibly damaging 0.80
Z1088:Rp1l1 UTSW 14 64030378 missense probably benign 0.01
Z1176:Rp1l1 UTSW 14 64029144 missense probably damaging 1.00
Z1177:Rp1l1 UTSW 14 64032297 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGAATCCAGAATGGTACATG -3'
(R):5'- CTGGGACTGATAACTACCAATCTG -3'

Sequencing Primer
(F):5'- AGATGGCCTAGTCAGCCATCATTG -3'
(R):5'- AATCTGGTAGAGCCGCTGTC -3'
Posted On 2019-10-24