Incidental Mutation 'R0622:Klhl29'
ID 58742
Institutional Source Beutler Lab
Gene Symbol Klhl29
Ensembl Gene ENSMUSG00000020627
Gene Name kelch-like 29
Synonyms Kbtbd9, A230106N14Rik
MMRRC Submission 038811-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R0622 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 5127472-5425682 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5131224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 852 (L852P)
Ref Sequence ENSEMBL: ENSMUSP00000020958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020958] [ENSMUST00000218384]
AlphaFold Q80T74
Predicted Effect probably damaging
Transcript: ENSMUST00000020958
AA Change: L852P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020958
Gene: ENSMUSG00000020627
AA Change: L852P

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 50 75 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
BTB 329 431 2.07e-22 SMART
BACK 436 538 4.88e-32 SMART
Kelch 585 636 5.33e0 SMART
Kelch 637 683 5.42e-5 SMART
Kelch 684 730 5.42e-5 SMART
Kelch 731 778 5.44e-1 SMART
Kelch 779 821 2.54e-1 SMART
Kelch 822 870 4.01e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218384
AA Change: L791P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,565,664 (GRCm39) M243K probably benign Het
Ap1b1 A G 11: 4,987,707 (GRCm39) M744V probably damaging Het
Ccdc152 T C 15: 3,327,660 (GRCm39) N39S probably damaging Het
Cd163 G A 6: 124,294,311 (GRCm39) V490M probably damaging Het
Col6a5 G T 9: 105,803,051 (GRCm39) H1305N unknown Het
Cpb1 C A 3: 20,303,982 (GRCm39) D361Y probably damaging Het
Dchs1 T A 7: 105,412,656 (GRCm39) Y1248F probably damaging Het
Dhdds G C 4: 133,721,547 (GRCm39) F83L probably damaging Het
Dsg4 T A 18: 20,582,845 (GRCm39) V161E possibly damaging Het
Exosc4 A G 15: 76,211,736 (GRCm39) D15G probably damaging Het
F3 A T 3: 121,518,668 (GRCm39) D44V probably damaging Het
Fat2 A T 11: 55,173,954 (GRCm39) F2253Y probably damaging Het
Fbn1 T C 2: 125,220,944 (GRCm39) D650G possibly damaging Het
Gramd4 T A 15: 85,975,590 (GRCm39) F36I probably damaging Het
Grm7 G A 6: 111,335,457 (GRCm39) A623T probably damaging Het
Gys1 A T 7: 45,089,419 (GRCm39) T193S probably damaging Het
Hectd4 A G 5: 121,486,688 (GRCm39) T3228A possibly damaging Het
Itpk1 G T 12: 102,540,239 (GRCm39) D281E probably damaging Het
Kcnh7 A C 2: 62,667,633 (GRCm39) probably null Het
Lrch1 T C 14: 75,033,491 (GRCm39) Y509C probably benign Het
Lrp1b A G 2: 41,618,563 (GRCm39) probably null Het
Mcpt4 C A 14: 56,298,119 (GRCm39) R144L probably benign Het
Mia2 C T 12: 59,178,364 (GRCm39) R12W probably damaging Het
Mrps5 A G 2: 127,436,451 (GRCm39) K116R probably benign Het
Myrf G A 19: 10,200,816 (GRCm39) P286S probably damaging Het
Nanp A G 2: 150,881,164 (GRCm39) M28T probably benign Het
Neb T C 2: 52,102,963 (GRCm39) I4472V probably benign Het
Nfix A C 8: 85,453,111 (GRCm39) N314K probably damaging Het
Nlrc3 C T 16: 3,771,832 (GRCm39) R849Q probably benign Het
Nup210l G A 3: 90,075,047 (GRCm39) V786M probably damaging Het
Or2t44 T C 11: 58,677,167 (GRCm39) S36P probably damaging Het
Or52ad1 A G 7: 102,996,064 (GRCm39) S24P probably damaging Het
Or6z5 T C 7: 6,477,598 (GRCm39) I163T possibly damaging Het
Or8c20 A G 9: 38,260,667 (GRCm39) N96S possibly damaging Het
Pdia4 A T 6: 47,783,452 (GRCm39) F197Y probably damaging Het
Phldb1 T C 9: 44,627,149 (GRCm39) D432G probably damaging Het
Pik3ca A G 3: 32,490,701 (GRCm39) E116G probably damaging Het
Polq T C 16: 36,881,355 (GRCm39) V1173A probably benign Het
Pou2f3 C T 9: 43,036,414 (GRCm39) R423H probably damaging Het
Pramel29 T C 4: 143,939,583 (GRCm39) probably benign Het
Prkag2 T C 5: 25,074,247 (GRCm39) N246S probably damaging Het
Proser1 A G 3: 53,385,281 (GRCm39) S388G probably benign Het
Ralgps1 G A 2: 33,064,459 (GRCm39) R238* probably null Het
Rfx2 T C 17: 57,084,071 (GRCm39) D657G probably damaging Het
Ryr3 A G 2: 112,492,900 (GRCm39) F3724S probably damaging Het
Sh2d5 T C 4: 137,986,539 (GRCm39) S421P probably damaging Het
Slc34a1 C A 13: 23,996,594 (GRCm39) T33K probably damaging Het
St8sia5 A G 18: 77,333,809 (GRCm39) T156A probably damaging Het
Stk32c T C 7: 138,768,026 (GRCm39) D85G probably benign Het
Tnks A G 8: 35,407,976 (GRCm39) S251P probably damaging Het
Tnxb T A 17: 34,937,703 (GRCm39) L3864Q probably damaging Het
Trim9 A G 12: 70,393,378 (GRCm39) Y189H probably damaging Het
Vmn1r77 T G 7: 11,775,315 (GRCm39) F30L probably benign Het
Wasf3 A G 5: 146,403,602 (GRCm39) probably null Het
Wdr90 C T 17: 26,074,632 (GRCm39) C603Y probably damaging Het
Zdhhc25 T C 15: 88,485,310 (GRCm39) L215P probably damaging Het
Zeb1 C T 18: 5,759,123 (GRCm39) Q140* probably null Het
Zfp677 C T 17: 21,617,962 (GRCm39) L340F probably benign Het
Other mutations in Klhl29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Klhl29 APN 12 5,190,705 (GRCm39) missense probably benign 0.01
IGL02639:Klhl29 APN 12 5,187,453 (GRCm39) missense probably damaging 0.96
IGL03142:Klhl29 APN 12 5,187,603 (GRCm39) missense probably damaging 1.00
bauxite UTSW 12 5,141,347 (GRCm39) missense probably damaging 0.98
Kerosene UTSW 12 5,141,030 (GRCm39) missense probably damaging 0.98
Mineral UTSW 12 5,133,995 (GRCm39) missense probably damaging 0.99
tungsten UTSW 12 5,140,995 (GRCm39) nonsense probably null
N/A - 535:Klhl29 UTSW 12 5,134,019 (GRCm39) missense probably damaging 1.00
R0347:Klhl29 UTSW 12 5,134,354 (GRCm39) missense probably damaging 0.97
R0631:Klhl29 UTSW 12 5,144,883 (GRCm39) missense probably benign 0.08
R0784:Klhl29 UTSW 12 5,131,251 (GRCm39) missense probably damaging 1.00
R1157:Klhl29 UTSW 12 5,140,650 (GRCm39) missense possibly damaging 0.89
R1521:Klhl29 UTSW 12 5,141,307 (GRCm39) missense probably damaging 1.00
R1535:Klhl29 UTSW 12 5,134,486 (GRCm39) missense probably damaging 1.00
R1599:Klhl29 UTSW 12 5,143,538 (GRCm39) missense probably damaging 1.00
R2049:Klhl29 UTSW 12 5,187,876 (GRCm39) missense probably damaging 0.96
R2568:Klhl29 UTSW 12 5,141,350 (GRCm39) missense probably damaging 0.96
R2883:Klhl29 UTSW 12 5,134,036 (GRCm39) missense probably damaging 1.00
R3724:Klhl29 UTSW 12 5,140,603 (GRCm39) missense probably damaging 0.99
R3951:Klhl29 UTSW 12 5,190,660 (GRCm39) missense probably damaging 1.00
R5031:Klhl29 UTSW 12 5,141,334 (GRCm39) missense probably benign 0.05
R5078:Klhl29 UTSW 12 5,143,530 (GRCm39) missense possibly damaging 0.82
R5410:Klhl29 UTSW 12 5,141,366 (GRCm39) missense probably benign 0.36
R5619:Klhl29 UTSW 12 5,190,587 (GRCm39) missense probably benign 0.23
R5681:Klhl29 UTSW 12 5,140,669 (GRCm39) missense possibly damaging 0.56
R6028:Klhl29 UTSW 12 5,140,995 (GRCm39) nonsense probably null
R6294:Klhl29 UTSW 12 5,133,995 (GRCm39) missense probably damaging 0.99
R6394:Klhl29 UTSW 12 5,187,720 (GRCm39) missense probably benign 0.00
R6394:Klhl29 UTSW 12 5,144,830 (GRCm39) nonsense probably null
R6475:Klhl29 UTSW 12 5,141,030 (GRCm39) missense probably damaging 0.98
R6737:Klhl29 UTSW 12 5,260,124 (GRCm39) missense possibly damaging 0.68
R6781:Klhl29 UTSW 12 5,141,347 (GRCm39) missense probably damaging 0.98
R6788:Klhl29 UTSW 12 5,134,393 (GRCm39) missense probably damaging 1.00
R7741:Klhl29 UTSW 12 5,187,500 (GRCm39) missense possibly damaging 0.49
R8709:Klhl29 UTSW 12 5,140,681 (GRCm39) missense probably damaging 1.00
R8886:Klhl29 UTSW 12 5,187,542 (GRCm39) missense possibly damaging 0.48
R8888:Klhl29 UTSW 12 5,187,542 (GRCm39) missense possibly damaging 0.48
R8954:Klhl29 UTSW 12 5,187,542 (GRCm39) missense possibly damaging 0.48
R8971:Klhl29 UTSW 12 5,190,710 (GRCm39) critical splice acceptor site probably null
R9031:Klhl29 UTSW 12 5,140,537 (GRCm39) missense probably damaging 1.00
R9066:Klhl29 UTSW 12 5,260,114 (GRCm39) missense probably benign 0.01
R9432:Klhl29 UTSW 12 5,260,056 (GRCm39) missense probably benign 0.00
R9509:Klhl29 UTSW 12 5,190,629 (GRCm39) missense probably damaging 0.98
R9733:Klhl29 UTSW 12 5,190,641 (GRCm39) missense probably damaging 1.00
Z1177:Klhl29 UTSW 12 5,131,152 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TCTTCACCCAAAAGGCGAGGATG -3'
(R):5'- GAGATTCACGGCCTAACTCTCTGC -3'

Sequencing Primer
(F):5'- CCAAAAGGCGAGGATGATTTTCTAC -3'
(R):5'- AACTCTCTGCCCCCTCC -3'
Posted On 2013-07-11