Incidental Mutation 'R7591:Vwa5b2'
ID 587424
Institutional Source Beutler Lab
Gene Symbol Vwa5b2
Ensembl Gene ENSMUSG00000046613
Gene Name von Willebrand factor A domain containing 5B2
Synonyms EG328644
MMRRC Submission 045638-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R7591 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 20408221-20424127 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20420317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 742 (E742G)
Ref Sequence ENSEMBL: ENSMUSP00000093911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045918] [ENSMUST00000096197] [ENSMUST00000100074] [ENSMUST00000123774] [ENSMUST00000147867] [ENSMUST00000149236] [ENSMUST00000159780] [ENSMUST00000231362] [ENSMUST00000231386] [ENSMUST00000231387] [ENSMUST00000231471] [ENSMUST00000231531] [ENSMUST00000231749] [ENSMUST00000231904] [ENSMUST00000232319] [ENSMUST00000232451] [ENSMUST00000232458]
AlphaFold Q3UR50
Predicted Effect probably benign
Transcript: ENSMUST00000045918
SMART Domains Protein: ENSMUSP00000045272
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
Pfam:ALG3 47 406 2.5e-145 PFAM
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096197
AA Change: E742G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093911
Gene: ENSMUSG00000046613
AA Change: E742G

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.3e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100074
SMART Domains Protein: ENSMUSP00000097652
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 1.9e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 572 586 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123774
SMART Domains Protein: ENSMUSP00000123378
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127454
SMART Domains Protein: ENSMUSP00000120559
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ALG3 51 118 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147867
Predicted Effect probably benign
Transcript: ENSMUST00000149236
SMART Domains Protein: ENSMUSP00000124117
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.9e-32 PFAM
Blast:VWA 352 408 2e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159780
AA Change: E742G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123727
Gene: ENSMUSG00000046613
AA Change: E742G

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 5.5e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231362
Predicted Effect probably benign
Transcript: ENSMUST00000231386
Predicted Effect probably benign
Transcript: ENSMUST00000231387
Predicted Effect probably benign
Transcript: ENSMUST00000231471
Predicted Effect probably benign
Transcript: ENSMUST00000231531
Predicted Effect probably benign
Transcript: ENSMUST00000231749
Predicted Effect probably benign
Transcript: ENSMUST00000231904
Predicted Effect probably benign
Transcript: ENSMUST00000232319
Predicted Effect probably benign
Transcript: ENSMUST00000232451
Predicted Effect probably benign
Transcript: ENSMUST00000232458
Meta Mutation Damage Score 0.1482 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccne2 T C 4: 11,201,393 (GRCm39) I307T probably benign Het
Chrm3 A T 13: 9,927,349 (GRCm39) C562* probably null Het
Cldn11 A T 3: 31,204,436 (GRCm39) E46D probably benign Het
Cyp4a14 A G 4: 115,347,157 (GRCm39) probably null Het
Dbh A G 2: 27,060,522 (GRCm39) T233A probably damaging Het
Dennd2c T A 3: 103,040,661 (GRCm39) Y309N possibly damaging Het
Dnttip2 T A 3: 122,070,117 (GRCm39) L444* probably null Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Epop A T 11: 97,519,158 (GRCm39) V317E probably damaging Het
Eppk1 T C 15: 75,991,797 (GRCm39) T1695A possibly damaging Het
Fam149a T A 8: 45,803,472 (GRCm39) I421F possibly damaging Het
Impa2 T C 18: 67,451,480 (GRCm39) L258P probably damaging Het
Itga1 G A 13: 115,119,315 (GRCm39) R855W probably damaging Het
Kcnh5 T C 12: 75,054,541 (GRCm39) T468A probably benign Het
Kif11 A G 19: 37,372,711 (GRCm39) K33R probably damaging Het
Lamb1 C A 12: 31,376,647 (GRCm39) A1657E probably damaging Het
Macc1 T C 12: 119,410,393 (GRCm39) V387A probably damaging Het
Nalcn T C 14: 123,561,297 (GRCm39) T734A probably benign Het
Nphp3 T C 9: 103,895,477 (GRCm39) probably null Het
Nutm2 A G 13: 50,627,903 (GRCm39) I461M probably damaging Het
Or14p1 T C 13: 65,292,462 (GRCm39) F130L probably benign Het
Or4p7 G A 2: 88,222,220 (GRCm39) V210M probably benign Het
Or4s2 A C 2: 88,473,811 (GRCm39) K233N probably damaging Het
Or5b112 A G 19: 13,319,619 (GRCm39) S166G probably benign Het
Pigo T C 4: 43,025,093 (GRCm39) N2S probably benign Het
Plcl1 A T 1: 55,736,608 (GRCm39) I650L probably benign Het
Ppcdc A T 9: 57,342,262 (GRCm39) V20D probably damaging Het
Pramel27 A T 4: 143,577,481 (GRCm39) I88L probably benign Het
Rhobtb2 A G 14: 70,037,190 (GRCm39) V78A possibly damaging Het
Rp1l1 T C 14: 64,263,558 (GRCm39) V226A probably damaging Het
Scrt1 C A 15: 76,403,694 (GRCm39) G99C probably damaging Het
Skint9 A T 4: 112,248,147 (GRCm39) I199N probably damaging Het
Slc5a4a T C 10: 75,983,501 (GRCm39) probably benign Het
Smad3 C T 9: 63,561,999 (GRCm39) W326* probably null Het
Spata18 A T 5: 73,829,759 (GRCm39) I305F Het
Spata31h1 C A 10: 82,128,046 (GRCm39) V1655F probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Syne3 A G 12: 104,906,863 (GRCm39) probably null Het
Trim69 G A 2: 121,998,454 (GRCm39) R142Q probably benign Het
Vmn1r40 A T 6: 89,691,755 (GRCm39) I191F probably benign Het
Vmn2r16 T A 5: 109,510,223 (GRCm39) D535E probably damaging Het
Zfp442 A T 2: 150,250,092 (GRCm39) Y603* probably null Het
Zp1 T C 19: 10,896,835 (GRCm39) N68S probably damaging Het
Other mutations in Vwa5b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Vwa5b2 APN 16 20,423,020 (GRCm39) missense probably benign
IGL01543:Vwa5b2 APN 16 20,414,466 (GRCm39) missense probably benign 0.02
IGL01719:Vwa5b2 APN 16 20,416,183 (GRCm39) critical splice donor site probably null
IGL02006:Vwa5b2 APN 16 20,415,843 (GRCm39) missense probably damaging 0.97
IGL02150:Vwa5b2 APN 16 20,423,576 (GRCm39) missense probably benign
IGL02301:Vwa5b2 APN 16 20,423,540 (GRCm39) missense probably damaging 1.00
IGL02373:Vwa5b2 APN 16 20,423,594 (GRCm39) missense probably damaging 0.99
IGL02413:Vwa5b2 APN 16 20,416,851 (GRCm39) missense probably damaging 1.00
IGL02664:Vwa5b2 APN 16 20,414,063 (GRCm39) unclassified probably benign
R1171:Vwa5b2 UTSW 16 20,423,734 (GRCm39) missense probably benign
R1405:Vwa5b2 UTSW 16 20,423,066 (GRCm39) missense probably benign 0.00
R1405:Vwa5b2 UTSW 16 20,423,066 (GRCm39) missense probably benign 0.00
R1464:Vwa5b2 UTSW 16 20,415,019 (GRCm39) missense probably benign 0.08
R1464:Vwa5b2 UTSW 16 20,415,019 (GRCm39) missense probably benign 0.08
R1730:Vwa5b2 UTSW 16 20,419,675 (GRCm39) missense probably damaging 1.00
R1901:Vwa5b2 UTSW 16 20,423,582 (GRCm39) missense possibly damaging 0.77
R1902:Vwa5b2 UTSW 16 20,423,582 (GRCm39) missense possibly damaging 0.77
R1903:Vwa5b2 UTSW 16 20,423,582 (GRCm39) missense possibly damaging 0.77
R1959:Vwa5b2 UTSW 16 20,420,941 (GRCm39) critical splice donor site probably null
R1961:Vwa5b2 UTSW 16 20,420,941 (GRCm39) critical splice donor site probably null
R3522:Vwa5b2 UTSW 16 20,420,358 (GRCm39) missense probably damaging 0.99
R3687:Vwa5b2 UTSW 16 20,410,308 (GRCm39) unclassified probably benign
R3746:Vwa5b2 UTSW 16 20,417,076 (GRCm39) intron probably benign
R3747:Vwa5b2 UTSW 16 20,417,076 (GRCm39) intron probably benign
R3749:Vwa5b2 UTSW 16 20,417,076 (GRCm39) intron probably benign
R3952:Vwa5b2 UTSW 16 20,417,111 (GRCm39) makesense probably null
R4641:Vwa5b2 UTSW 16 20,423,393 (GRCm39) missense probably damaging 1.00
R4646:Vwa5b2 UTSW 16 20,415,079 (GRCm39) missense probably damaging 1.00
R4772:Vwa5b2 UTSW 16 20,419,553 (GRCm39) splice site probably null
R5032:Vwa5b2 UTSW 16 20,419,459 (GRCm39) missense probably damaging 1.00
R5286:Vwa5b2 UTSW 16 20,415,058 (GRCm39) missense probably damaging 1.00
R5569:Vwa5b2 UTSW 16 20,414,089 (GRCm39) missense probably damaging 1.00
R5585:Vwa5b2 UTSW 16 20,413,428 (GRCm39) nonsense probably null
R5640:Vwa5b2 UTSW 16 20,416,292 (GRCm39) missense probably damaging 1.00
R6330:Vwa5b2 UTSW 16 20,420,727 (GRCm39) missense probably damaging 1.00
R6459:Vwa5b2 UTSW 16 20,413,429 (GRCm39) missense probably damaging 0.98
R6992:Vwa5b2 UTSW 16 20,416,952 (GRCm39) missense probably damaging 1.00
R7102:Vwa5b2 UTSW 16 20,422,984 (GRCm39) missense probably benign 0.00
R7231:Vwa5b2 UTSW 16 20,422,878 (GRCm39) missense probably benign 0.00
R7765:Vwa5b2 UTSW 16 20,413,361 (GRCm39) missense probably benign
R8269:Vwa5b2 UTSW 16 20,423,188 (GRCm39) missense probably damaging 1.00
R8311:Vwa5b2 UTSW 16 20,409,972 (GRCm39) missense probably damaging 1.00
R8707:Vwa5b2 UTSW 16 20,412,965 (GRCm39) missense probably benign 0.01
R8716:Vwa5b2 UTSW 16 20,415,026 (GRCm39) missense probably benign 0.00
R8815:Vwa5b2 UTSW 16 20,419,516 (GRCm39) missense probably damaging 1.00
R8965:Vwa5b2 UTSW 16 20,415,076 (GRCm39) missense possibly damaging 0.72
R9245:Vwa5b2 UTSW 16 20,416,890 (GRCm39) missense probably damaging 1.00
R9431:Vwa5b2 UTSW 16 20,423,046 (GRCm39) missense probably benign 0.00
R9536:Vwa5b2 UTSW 16 20,414,449 (GRCm39) missense probably damaging 1.00
R9695:Vwa5b2 UTSW 16 20,422,975 (GRCm39) missense probably benign
R9727:Vwa5b2 UTSW 16 20,423,477 (GRCm39) missense probably damaging 1.00
Z1176:Vwa5b2 UTSW 16 20,410,003 (GRCm39) missense probably damaging 0.99
Z1177:Vwa5b2 UTSW 16 20,419,401 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGCGCTCAGTCAGAATG -3'
(R):5'- TTACCTGAATCATCGAGGCC -3'

Sequencing Primer
(F):5'- TCAGAATGACTGTCAGACGGAGTTAG -3'
(R):5'- TGAATCATCGAGGCCCTGAC -3'
Posted On 2019-10-24