Incidental Mutation 'R0622:Trim9'
ID58743
Institutional Source Beutler Lab
Gene Symbol Trim9
Ensembl Gene ENSMUSG00000021071
Gene Nametripartite motif-containing 9
Synonyms
MMRRC Submission 038811-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R0622 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location70244533-70347614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70346604 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 189 (Y189H)
Ref Sequence ENSEMBL: ENSMUSP00000152887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000167755] [ENSMUST00000221041] [ENSMUST00000221370] [ENSMUST00000222316] [ENSMUST00000223160]
Predicted Effect probably damaging
Transcript: ENSMUST00000110520
AA Change: Y189H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: Y189H

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Pfam:SPRY 598 702 2.4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110522
AA Change: Y189H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: Y189H

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
low complexity region 591 605 N/A INTRINSIC
Pfam:SPRY 674 776 1.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167755
AA Change: Y189H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127081
Gene: ENSMUSG00000021071
AA Change: Y189H

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221041
AA Change: Y189H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000221294
AA Change: Y162H
Predicted Effect probably damaging
Transcript: ENSMUST00000221370
AA Change: Y189H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000222316
AA Change: Y189H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000223160
AA Change: Y189H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223521
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Trim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Trim9 APN 12 70347113 missense probably damaging 0.98
IGL01618:Trim9 APN 12 70248351 missense probably benign
IGL01794:Trim9 APN 12 70281880 missense probably damaging 1.00
IGL03101:Trim9 APN 12 70346654 missense probably damaging 1.00
IGL03184:Trim9 APN 12 70251221 missense probably damaging 0.99
E0354:Trim9 UTSW 12 70272459 missense probably benign 0.01
IGL03098:Trim9 UTSW 12 70280693 missense possibly damaging 0.95
R0518:Trim9 UTSW 12 70346585 missense probably damaging 0.99
R0941:Trim9 UTSW 12 70248263 missense probably damaging 0.97
R1022:Trim9 UTSW 12 70252017 splice site probably null
R1024:Trim9 UTSW 12 70252017 splice site probably null
R1204:Trim9 UTSW 12 70346727 missense probably damaging 1.00
R1439:Trim9 UTSW 12 70251093 missense probably damaging 1.00
R1530:Trim9 UTSW 12 70272428 missense probably damaging 0.98
R1613:Trim9 UTSW 12 70248395 missense probably damaging 1.00
R1661:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1665:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1722:Trim9 UTSW 12 70248374 missense probably benign 0.33
R2097:Trim9 UTSW 12 70347159 missense probably damaging 1.00
R3082:Trim9 UTSW 12 70255113 missense possibly damaging 0.93
R3123:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3124:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3125:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3738:Trim9 UTSW 12 70251195 missense probably damaging 1.00
R4013:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4017:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4560:Trim9 UTSW 12 70347118 nonsense probably null
R4734:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4748:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4749:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4777:Trim9 UTSW 12 70347071 missense probably damaging 1.00
R5027:Trim9 UTSW 12 70346708 missense probably damaging 0.96
R5451:Trim9 UTSW 12 70346829 missense probably benign 0.17
R5471:Trim9 UTSW 12 70346792 missense possibly damaging 0.93
R6394:Trim9 UTSW 12 70255213 missense possibly damaging 0.91
R6901:Trim9 UTSW 12 70346639 missense probably damaging 0.96
R7549:Trim9 UTSW 12 70346941 missense probably damaging 1.00
R7690:Trim9 UTSW 12 70248343 missense probably benign
R7895:Trim9 UTSW 12 70255187 missense probably benign 0.03
R7978:Trim9 UTSW 12 70255187 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACACGGGCATCTTGCATTGCAC -3'
(R):5'- TCTATCGGGAGCCCATCATCTTGC -3'

Sequencing Primer
(F):5'- CATTGCACGCAGTACATGC -3'
(R):5'- CTGACTATGATTATCTGGACCTGGAC -3'
Posted On2013-07-11