Mutagenetix > Incidental Mutations

Incidental Mutation 'R0622:Trim9'

58743

Institutional Source

Beutler Lab

Gene Symbol

Trim9

Ensembl Gene

ENSMUSG00000021071

Gene Name

tripartite motif-containing 9

Synonyms

MMRRC Submission

038811-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.283) question?

Stock #

R0622 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70244533-70347614 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70346604 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 189 (Y189H)

Ref Sequence

ENSEMBL: ENSMUSP00000152887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000167755] [ENSMUST00000221041] [ENSMUST00000221370] [ENSMUST00000222316] [ENSMUST00000223160]

Predicted Effect

probably damaging
Transcript: ENSMUST00000110520
AA Change: Y189H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: Y189H

Domain	Start	End	E-Value	Type
RING	10	131	1.23e-4	SMART
BBOX	163	212	2.84e-9	SMART
BBOX	224	266	9.89e-9	SMART
BBC	273	399	1.29e-38	SMART
FN3	439	522	4.09e-7	SMART
Pfam:SPRY	598	702	2.4e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110522
AA Change: Y189H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: Y189H

Domain	Start	End	E-Value	Type
RING	10	131	1.23e-4	SMART
BBOX	163	212	2.84e-9	SMART
BBOX	224	266	9.89e-9	SMART
BBC	273	399	1.29e-38	SMART
FN3	439	522	4.09e-7	SMART
low complexity region	591	605	N/A	INTRINSIC
Pfam:SPRY	674	776	1.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000167755
AA Change: Y189H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127081
Gene: ENSMUSG00000021071
AA Change: Y189H

Domain	Start	End	E-Value	Type
RING	10	131	1.23e-4	SMART
BBOX	163	212	2.84e-9	SMART
BBOX	224	266	9.89e-9	SMART
BBC	273	399	1.29e-38	SMART
FN3	439	522	4.09e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000221041
AA Change: Y189H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

unknown
Transcript: ENSMUST00000221294
AA Change: Y162H

Predicted Effect

probably damaging
Transcript: ENSMUST00000221370
AA Change: Y189H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000222316
AA Change: Y189H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223160
AA Change: Y189H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223521

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtr1a	T	A	13: 30,381,681	M243K	probably benign	Het
Ap1b1	A	G	11: 5,037,707	M744V	probably damaging	Het
C87977	T	C	4: 144,213,013		probably benign	Het
Ccdc152	T	C	15: 3,298,178	N39S	probably damaging	Het
Cd163	G	A	6: 124,317,352	V490M	probably damaging	Het
Col6a5	G	T	9: 105,925,852	H1305N	unknown	Het
Cpb1	C	A	3: 20,249,818	D361Y	probably damaging	Het
Dchs1	T	A	7: 105,763,449	Y1248F	probably damaging	Het
Dhdds	G	C	4: 133,994,236	F83L	probably damaging	Het
Dsg4	T	A	18: 20,449,788	V161E	possibly damaging	Het
Exosc4	A	G	15: 76,327,536	D15G	probably damaging	Het
F3	A	T	3: 121,725,019	D44V	probably damaging	Het
Fat2	A	T	11: 55,283,128	F2253Y	probably damaging	Het
Fbn1	T	C	2: 125,379,024	D650G	possibly damaging	Het
Gramd4	T	A	15: 86,091,389	F36I	probably damaging	Het
Grm7	G	A	6: 111,358,496	A623T	probably damaging	Het
Gys1	A	T	7: 45,439,995	T193S	probably damaging	Het
Hectd4	A	G	5: 121,348,625	T3228A	possibly damaging	Het
Itpk1	G	T	12: 102,573,980	D281E	probably damaging	Het
Kcnh7	A	C	2: 62,837,289		probably null	Het
Klhl29	A	G	12: 5,081,224	L852P	probably damaging	Het
Lrch1	T	C	14: 74,796,051	Y509C	probably benign	Het
Lrp1b	A	G	2: 41,728,551		probably null	Het
Mcpt4	C	A	14: 56,060,662	R144L	probably benign	Het
Mia2	C	T	12: 59,131,578	R12W	probably damaging	Het
Mrps5	A	G	2: 127,594,531	K116R	probably benign	Het
Myrf	G	A	19: 10,223,452	P286S	probably damaging	Het
Nanp	A	G	2: 151,039,244	M28T	probably benign	Het
Neb	T	C	2: 52,212,951	I4472V	probably benign	Het
Nfix	A	C	8: 84,726,482	N314K	probably damaging	Het
Nlrc3	C	T	16: 3,953,968	R849Q	probably benign	Het
Nup210l	G	A	3: 90,167,740	V786M	probably damaging	Het
Olfr1346	T	C	7: 6,474,599	I163T	possibly damaging	Het
Olfr314	T	C	11: 58,786,341	S36P	probably damaging	Het
Olfr600	A	G	7: 103,346,857	S24P	probably damaging	Het
Olfr898	A	G	9: 38,349,371	N96S	possibly damaging	Het
Pdia4	A	T	6: 47,806,518	F197Y	probably damaging	Het
Phldb1	T	C	9: 44,715,852	D432G	probably damaging	Het
Pik3ca	A	G	3: 32,436,552	E116G	probably damaging	Het
Polq	T	C	16: 37,060,993	V1173A	probably benign	Het
Pou2f3	C	T	9: 43,125,119	R423H	probably damaging	Het
Prkag2	T	C	5: 24,869,249	N246S	probably damaging	Het
Proser1	A	G	3: 53,477,860	S388G	probably benign	Het
Ralgps1	G	A	2: 33,174,447	R238*	probably null	Het
Rfx2	T	C	17: 56,777,071	D657G	probably damaging	Het
Ryr3	A	G	2: 112,662,555	F3724S	probably damaging	Het
Sh2d5	T	C	4: 138,259,228	S421P	probably damaging	Het
Slc17a2	C	A	13: 23,812,611	T33K	probably damaging	Het
St8sia5	A	G	18: 77,246,113	T156A	probably damaging	Het
Stk32c	T	C	7: 139,188,110	D85G	probably benign	Het
Tnks	A	G	8: 34,940,822	S251P	probably damaging	Het
Tnxb	T	A	17: 34,718,729	L3864Q	probably damaging	Het
Vmn1r77	T	G	7: 12,041,388	F30L	probably benign	Het
Wasf3	A	G	5: 146,466,792		probably null	Het
Wdr90	C	T	17: 25,855,658	C603Y	probably damaging	Het
Zdhhc25	T	C	15: 88,601,107	L215P	probably damaging	Het
Zeb1	C	T	18: 5,759,123	Q140*	probably null	Het
Zfp677	C	T	17: 21,397,700	L340F	probably benign	Het

Other mutations in Trim9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00910:Trim9	APN	12	70347113	missense	probably damaging	0.98
IGL01618:Trim9	APN	12	70248351	missense	probably benign
IGL01794:Trim9	APN	12	70281880	missense	probably damaging	1.00
IGL03101:Trim9	APN	12	70346654	missense	probably damaging	1.00
IGL03184:Trim9	APN	12	70251221	missense	probably damaging	0.99
E0354:Trim9	UTSW	12	70272459	missense	probably benign	0.01
IGL03098:Trim9	UTSW	12	70280693	missense	possibly damaging	0.95
R0518:Trim9	UTSW	12	70346585	missense	probably damaging	0.99
R0941:Trim9	UTSW	12	70248263	missense	probably damaging	0.97
R1022:Trim9	UTSW	12	70252017	splice site	probably null
R1024:Trim9	UTSW	12	70252017	splice site	probably null
R1204:Trim9	UTSW	12	70346727	missense	probably damaging	1.00
R1439:Trim9	UTSW	12	70251093	missense	probably damaging	1.00
R1530:Trim9	UTSW	12	70272428	missense	probably damaging	0.98
R1613:Trim9	UTSW	12	70248395	missense	probably damaging	1.00
R1661:Trim9	UTSW	12	70255113	missense	probably damaging	0.99
R1665:Trim9	UTSW	12	70255113	missense	probably damaging	0.99
R1722:Trim9	UTSW	12	70248374	missense	probably benign	0.33
R2097:Trim9	UTSW	12	70347159	missense	probably damaging	1.00
R3082:Trim9	UTSW	12	70255113	missense	possibly damaging	0.93
R3123:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3124:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3125:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3738:Trim9	UTSW	12	70251195	missense	probably damaging	1.00
R4013:Trim9	UTSW	12	70346352	missense	probably damaging	1.00
R4017:Trim9	UTSW	12	70346352	missense	probably damaging	1.00
R4560:Trim9	UTSW	12	70347118	nonsense	probably null
R4734:Trim9	UTSW	12	70248273	missense	probably damaging	1.00
R4748:Trim9	UTSW	12	70248273	missense	probably damaging	1.00
R4749:Trim9	UTSW	12	70248273	missense	probably damaging	1.00
R4777:Trim9	UTSW	12	70347071	missense	probably damaging	1.00
R5027:Trim9	UTSW	12	70346708	missense	probably damaging	0.96
R5451:Trim9	UTSW	12	70346829	missense	probably benign	0.17
R5471:Trim9	UTSW	12	70346792	missense	possibly damaging	0.93
R6394:Trim9	UTSW	12	70255213	missense	possibly damaging	0.91
R6901:Trim9	UTSW	12	70346639	missense	probably damaging	0.96
R7549:Trim9	UTSW	12	70346941	missense	probably damaging	1.00
R7690:Trim9	UTSW	12	70248343	missense	probably benign
R7895:Trim9	UTSW	12	70255187	missense	probably benign	0.03
R7978:Trim9	UTSW	12	70255187	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACACGGGCATCTTGCATTGCAC -3'
(R):5'- TCTATCGGGAGCCCATCATCTTGC -3'

Sequencing Primer
(F):5'- CATTGCACGCAGTACATGC -3'
(R):5'- CTGACTATGATTATCTGGACCTGGAC -3'

Posted On

2013-07-11