Incidental Mutation 'R7592:Stil'
ID 587440
Institutional Source Beutler Lab
Gene Symbol Stil
Ensembl Gene ENSMUSG00000028718
Gene Name Scl/Tal1 interrupting locus
Synonyms Sil
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7592 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 115000159-115043196 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115023808 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 516 (D516E)
Ref Sequence ENSEMBL: ENSMUSP00000030490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030490] [ENSMUST00000129957] [ENSMUST00000141933]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030490
AA Change: D516E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030490
Gene: ENSMUSG00000028718
AA Change: D516E

DomainStartEndE-ValueType
Pfam:STIL_N 22 426 5.1e-199 PFAM
low complexity region 709 724 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129957
SMART Domains Protein: ENSMUSP00000123385
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 22 416 1.5e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141933
SMART Domains Protein: ENSMUSP00000118849
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 22 392 6.6e-166 PFAM
Meta Mutation Damage Score 0.0750 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a centrosomal protein ubiquitously expressed in proliferating cells and during early embryonic development. Mice lacking the encoded protein die in utero with marked growth retardation, defects in the developing neural fold and randomization of left-right asymmetry. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with various neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,849,274 T204A unknown Het
Abca12 T C 1: 71,288,677 T1415A probably benign Het
Adamtsl3 A G 7: 82,337,251 T24A probably benign Het
Ankrd13b A C 11: 77,476,501 V194G probably benign Het
Aurkc C T 7: 7,000,007 T167I probably benign Het
BC100530 A T 16: 36,367,500 M1K probably null Het
Capn1 T C 19: 6,014,439 Y10C probably benign Het
Ccnk T C 12: 108,186,465 S14P possibly damaging Het
Cebpe T A 14: 54,711,841 I40F probably damaging Het
Cers3 G A 7: 66,789,629 C296Y probably damaging Het
Cog8 A T 8: 107,050,229 C505S possibly damaging Het
Col4a3 A G 1: 82,648,617 I92V unknown Het
Col5a3 T A 9: 20,797,393 H645L unknown Het
Crispld1 A T 1: 17,728,766 E37V possibly damaging Het
Csmd2 A G 4: 128,463,798 Y1684C Het
Dcst1 C A 3: 89,353,292 S555I probably benign Het
Drc1 A G 5: 30,341,716 S70G possibly damaging Het
Elavl2 A T 4: 91,311,571 probably null Het
Emc1 A G 4: 139,360,566 H300R probably benign Het
Gcnt4 G A 13: 96,947,161 V322I probably benign Het
Gsg1l2 A G 11: 67,774,758 N51D probably benign Het
Gucy2e A T 11: 69,223,324 probably null Het
Hip1r A G 5: 123,997,973 E579G probably benign Het
Hoxa4 T C 6: 52,191,540 H50R unknown Het
Htr7 T C 19: 36,056,892 Y121C probably damaging Het
Ift43 G A 12: 86,161,190 D111N probably damaging Het
Itih3 A G 14: 30,908,765 V863A probably damaging Het
Macf1 T C 4: 123,410,893 probably benign Het
Mgat3 A G 15: 80,210,992 K7E probably damaging Het
Ndst4 T A 3: 125,570,787 V371E probably damaging Het
Npr1 T G 3: 90,465,016 D163A possibly damaging Het
Nudt12 T C 17: 59,006,594 I330V probably benign Het
Olfr434 T G 6: 43,217,245 C111G probably damaging Het
Olfr630 C A 7: 103,755,072 C171F probably damaging Het
Olfr730 T A 14: 50,186,563 Y219F probably damaging Het
Olfr850 C A 9: 19,477,832 M139I possibly damaging Het
Poc1a A T 9: 106,349,768 R402S probably benign Het
Prex2 G T 1: 11,123,213 V470L probably damaging Het
Prom1 T C 5: 44,063,127 E93G probably damaging Het
Psma1 A T 7: 114,269,726 M180K probably benign Het
Pudp A T 18: 50,567,982 F227I probably damaging Het
Rab15 T A 12: 76,804,449 Q60L probably damaging Het
Scaf8 T C 17: 3,171,222 probably null Het
Sept9 T A 11: 117,290,662 I96N probably damaging Het
Sez6 T C 11: 77,978,050 S976P probably damaging Het
Slc2a12 A G 10: 22,664,903 Y219C probably damaging Het
Slc38a9 T A 13: 112,695,355 I213K probably damaging Het
Supt20 A G 3: 54,707,122 D184G probably damaging Het
Tarsl2 G A 7: 65,658,871 S263N probably benign Het
Tmem181a C A 17: 6,289,020 T68K probably benign Het
Trav21-dv12 G T 14: 53,876,540 C39F probably damaging Het
Tshz1 T C 18: 84,014,048 E745G probably damaging Het
Ugt1a8 T A 1: 88,088,182 F106I probably benign Het
Vmn1r39 C A 6: 66,804,444 V297L probably benign Het
Vmn2r101 G A 17: 19,591,181 probably null Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Other mutations in Stil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Stil APN 4 115024112 missense probably benign 0.29
IGL01672:Stil APN 4 115032789 missense probably damaging 1.00
IGL02058:Stil APN 4 115014162 missense probably benign 0.00
IGL02076:Stil APN 4 115023637 missense probably benign 0.03
IGL02104:Stil APN 4 115041482 missense probably damaging 1.00
IGL02355:Stil APN 4 115010111 missense probably damaging 1.00
IGL02362:Stil APN 4 115010111 missense probably damaging 1.00
IGL02612:Stil APN 4 115023696 missense possibly damaging 0.80
IGL02695:Stil APN 4 115016175 missense probably damaging 1.00
IGL02696:Stil APN 4 115041495 missense probably damaging 0.99
IGL02826:Stil APN 4 115024098 missense probably benign 0.01
IGL02946:Stil APN 4 115029913 missense probably benign 0.05
IGL03146:Stil APN 4 115024415 missense probably damaging 1.00
BB005:Stil UTSW 4 115030001 missense probably damaging 0.98
BB015:Stil UTSW 4 115030001 missense probably damaging 0.98
R0058:Stil UTSW 4 115041298 missense probably damaging 1.00
R0256:Stil UTSW 4 115023685 missense possibly damaging 0.80
R0324:Stil UTSW 4 115039149 missense probably benign 0.01
R0391:Stil UTSW 4 115041172 critical splice acceptor site probably null
R0602:Stil UTSW 4 115024423 splice site probably benign
R0620:Stil UTSW 4 115007159 missense possibly damaging 0.52
R1452:Stil UTSW 4 115039195 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1544:Stil UTSW 4 115023852 missense probably damaging 0.97
R1789:Stil UTSW 4 115041782 missense probably benign 0.01
R1878:Stil UTSW 4 115041226 missense probably damaging 1.00
R1895:Stil UTSW 4 115023875 missense probably benign 0.40
R2325:Stil UTSW 4 115032707 missense probably benign 0.12
R2401:Stil UTSW 4 115016286 missense probably null 0.81
R3054:Stil UTSW 4 115004966 missense probably damaging 1.00
R3055:Stil UTSW 4 115014069 splice site probably benign
R4097:Stil UTSW 4 115023600 missense probably benign 0.04
R4330:Stil UTSW 4 115004979 missense probably damaging 1.00
R4418:Stil UTSW 4 115009377 missense probably benign 0.17
R4665:Stil UTSW 4 115041644 missense probably benign 0.00
R4688:Stil UTSW 4 115041308 missense probably damaging 1.00
R4740:Stil UTSW 4 115006782 missense probably benign 0.15
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4909:Stil UTSW 4 115024225 nonsense probably null
R6130:Stil UTSW 4 115029861 splice site probably null
R6523:Stil UTSW 4 115032714 frame shift probably null
R7294:Stil UTSW 4 115007283 missense probably benign 0.17
R7357:Stil UTSW 4 115014226 critical splice donor site probably null
R7387:Stil UTSW 4 115024036 missense probably benign 0.37
R7776:Stil UTSW 4 115032838 missense possibly damaging 0.49
R7908:Stil UTSW 4 115032699 missense possibly damaging 0.68
R7928:Stil UTSW 4 115030001 missense probably damaging 0.98
R9064:Stil UTSW 4 115041735 missense probably benign 0.00
R9140:Stil UTSW 4 115007252 missense probably damaging 1.00
R9500:Stil UTSW 4 115021519 missense possibly damaging 0.93
R9695:Stil UTSW 4 115024181 missense probably damaging 1.00
R9697:Stil UTSW 4 115021504 missense probably benign 0.45
Z1088:Stil UTSW 4 115006693 missense probably damaging 1.00
Z1177:Stil UTSW 4 115041379 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGATGCCAAACACAGCTCAG -3'
(R):5'- AACAGCTGCAGACGTTTGTG -3'

Sequencing Primer
(F):5'- TCAGAAGCTACCACTGGGG -3'
(R):5'- CTGCAGACGTTTGTGGGATAG -3'
Posted On 2019-10-24