Incidental Mutation 'R7592:Psma1'
ID587456
Institutional Source Beutler Lab
Gene Symbol Psma1
Ensembl Gene ENSMUSG00000030751
Gene Nameproteasome (prosome, macropain) subunit, alpha type 1
SynonymsC2, HC2, Pros-30
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R7592 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location114264606-114276118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114269726 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 180 (M180K)
Ref Sequence ENSEMBL: ENSMUSP00000033008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033008] [ENSMUST00000135570]
PDB Structure
Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033008
AA Change: M180K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033008
Gene: ENSMUSG00000030751
AA Change: M180K

DomainStartEndE-ValueType
Proteasome_A_N 6 28 6.32e-8 SMART
Pfam:Proteasome 29 215 3.2e-54 PFAM
low complexity region 243 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135570
AA Change: M155K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,849,274 T204A unknown Het
Abca12 T C 1: 71,288,677 T1415A probably benign Het
Adamtsl3 A G 7: 82,337,251 T24A probably benign Het
Ankrd13b A C 11: 77,476,501 V194G probably benign Het
Aurkc C T 7: 7,000,007 T167I probably benign Het
BC100530 A T 16: 36,367,500 M1K probably null Het
Capn1 T C 19: 6,014,439 Y10C probably benign Het
Ccnk T C 12: 108,186,465 S14P possibly damaging Het
Cebpe T A 14: 54,711,841 I40F probably damaging Het
Cers3 G A 7: 66,789,629 C296Y probably damaging Het
Cog8 A T 8: 107,050,229 C505S possibly damaging Het
Col4a3 A G 1: 82,648,617 I92V unknown Het
Col5a3 T A 9: 20,797,393 H645L unknown Het
Crispld1 A T 1: 17,728,766 E37V possibly damaging Het
Csmd2 A G 4: 128,463,798 Y1684C Het
Dcst1 C A 3: 89,353,292 S555I probably benign Het
Drc1 A G 5: 30,341,716 S70G possibly damaging Het
Elavl2 A T 4: 91,311,571 probably null Het
Emc1 A G 4: 139,360,566 H300R probably benign Het
Gcnt4 G A 13: 96,947,161 V322I probably benign Het
Gsg1l2 A G 11: 67,774,758 N51D probably benign Het
Gucy2e A T 11: 69,223,324 probably null Het
Hip1r A G 5: 123,997,973 E579G probably benign Het
Hoxa4 T C 6: 52,191,540 H50R unknown Het
Htr7 T C 19: 36,056,892 Y121C probably damaging Het
Ift43 G A 12: 86,161,190 D111N probably damaging Het
Itih3 A G 14: 30,908,765 V863A probably damaging Het
Macf1 T C 4: 123,410,893 probably benign Het
Mgat3 A G 15: 80,210,992 K7E probably damaging Het
Ndst4 T A 3: 125,570,787 V371E probably damaging Het
Npr1 T G 3: 90,465,016 D163A possibly damaging Het
Nudt12 T C 17: 59,006,594 I330V probably benign Het
Olfr434 T G 6: 43,217,245 C111G probably damaging Het
Olfr630 C A 7: 103,755,072 C171F probably damaging Het
Olfr730 T A 14: 50,186,563 Y219F probably damaging Het
Olfr850 C A 9: 19,477,832 M139I possibly damaging Het
Poc1a A T 9: 106,349,768 R402S probably benign Het
Prex2 G T 1: 11,123,213 V470L probably damaging Het
Prom1 T C 5: 44,063,127 E93G probably damaging Het
Pudp A T 18: 50,567,982 F227I probably damaging Het
Rab15 T A 12: 76,804,449 Q60L probably damaging Het
Scaf8 T C 17: 3,171,222 probably null Het
Sept9 T A 11: 117,290,662 I96N probably damaging Het
Sez6 T C 11: 77,978,050 S976P probably damaging Het
Slc2a12 A G 10: 22,664,903 Y219C probably damaging Het
Slc38a9 T A 13: 112,695,355 I213K probably damaging Het
Stil T A 4: 115,023,808 D516E probably benign Het
Supt20 A G 3: 54,707,122 D184G probably damaging Het
Tarsl2 G A 7: 65,658,871 S263N probably benign Het
Tmem181a C A 17: 6,289,020 T68K probably benign Het
Trav21-dv12 G T 14: 53,876,540 C39F probably damaging Het
Tshz1 T C 18: 84,014,048 E745G probably damaging Het
Ugt1a8 T A 1: 88,088,182 F106I probably benign Het
Vmn1r39 C A 6: 66,804,444 V297L probably benign Het
Vmn2r101 G A 17: 19,591,181 probably null Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Other mutations in Psma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03001:Psma1 APN 7 114266439 missense probably benign 0.01
tempt UTSW 7 114274448 missense probably damaging 1.00
R0046:Psma1 UTSW 7 114267205 splice site probably benign
R0046:Psma1 UTSW 7 114267205 splice site probably benign
R2062:Psma1 UTSW 7 114269766 missense possibly damaging 0.95
R2217:Psma1 UTSW 7 114264938 missense unknown
R4633:Psma1 UTSW 7 114271134 missense probably damaging 1.00
R5585:Psma1 UTSW 7 114274067 missense probably damaging 1.00
R6357:Psma1 UTSW 7 114274367 intron probably null
R7137:Psma1 UTSW 7 114274448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGACTTTTCAAGGTTGGAGAC -3'
(R):5'- CAGTTATATCCTAACAATGGTTTAGCC -3'

Sequencing Primer
(F):5'- TTAAAGGTGTGCGCTACCAC -3'
(R):5'- GGGCCCTCATATTTTCCA -3'
Posted On2019-10-24