Mutagenetix > Incidental Mutation

Incidental Mutation 'R7592:Col5a3'

587459

Institutional Source

Beutler Lab

Gene Symbol

Col5a3

Ensembl Gene

ENSMUSG00000004098

Gene Name

collagen, type V, alpha 3

Synonyms

Pro-alpha3(V)

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Essential gene?

Possibly non essential (E-score: 0.275) question?

Stock #

R7592 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20770050-20815067 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20797393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 645 (H645L)

Ref Sequence

ENSEMBL: ENSMUSP00000004201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004201]

AlphaFold

Q9JLI2

Predicted Effect

unknown
Transcript: ENSMUST00000004201
AA Change: H645L

SMART Domains

Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098
AA Change: H645L

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSPN	32	211	7.08e-28	SMART
LamG	89	210	2.13e-2	SMART
low complexity region	247	267	N/A	INTRINSIC
low complexity region	295	314	N/A	INTRINSIC
low complexity region	341	347	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
low complexity region	391	434	N/A	INTRINSIC
low complexity region	461	474	N/A	INTRINSIC
Pfam:Collagen	475	538	5.5e-10	PFAM
low complexity region	597	616	N/A	INTRINSIC
low complexity region	628	694	N/A	INTRINSIC
internal_repeat_3	703	737	7.13e-16	PROSPERO
low complexity region	742	821	N/A	INTRINSIC
low complexity region	823	844	N/A	INTRINSIC
low complexity region	859	889	N/A	INTRINSIC
internal_repeat_2	892	1081	5.05e-17	PROSPERO
internal_repeat_1	996	1133	7.47e-22	PROSPERO
internal_repeat_3	1105	1139	7.13e-16	PROSPERO
low complexity region	1140	1165	N/A	INTRINSIC
low complexity region	1168	1255	N/A	INTRINSIC
low complexity region	1258	1282	N/A	INTRINSIC
low complexity region	1285	1306	N/A	INTRINSIC
low complexity region	1311	1418	N/A	INTRINSIC
Pfam:Collagen	1429	1491	9.5e-10	PFAM
COLFI	1508	1738	7.98e-92	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (56/57)

MGI Phenotype

Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	A	G	16: 4,849,274	T204A	unknown	Het
Abca12	T	C	1: 71,288,677	T1415A	probably benign	Het
Adamtsl3	A	G	7: 82,337,251	T24A	probably benign	Het
Ankrd13b	A	C	11: 77,476,501	V194G	probably benign	Het
Aurkc	C	T	7: 7,000,007	T167I	probably benign	Het
BC100530	A	T	16: 36,367,500	M1K	probably null	Het
Capn1	T	C	19: 6,014,439	Y10C	probably benign	Het
Ccnk	T	C	12: 108,186,465	S14P	possibly damaging	Het
Cebpe	T	A	14: 54,711,841	I40F	probably damaging	Het
Cers3	G	A	7: 66,789,629	C296Y	probably damaging	Het
Cog8	A	T	8: 107,050,229	C505S	possibly damaging	Het
Col4a3	A	G	1: 82,648,617	I92V	unknown	Het
Crispld1	A	T	1: 17,728,766	E37V	possibly damaging	Het
Csmd2	A	G	4: 128,463,798	Y1684C		Het
Dcst1	C	A	3: 89,353,292	S555I	probably benign	Het
Drc1	A	G	5: 30,341,716	S70G	possibly damaging	Het
Elavl2	A	T	4: 91,311,571		probably null	Het
Emc1	A	G	4: 139,360,566	H300R	probably benign	Het
Gcnt4	G	A	13: 96,947,161	V322I	probably benign	Het
Gsg1l2	A	G	11: 67,774,758	N51D	probably benign	Het
Gucy2e	A	T	11: 69,223,324		probably null	Het
Hip1r	A	G	5: 123,997,973	E579G	probably benign	Het
Hoxa4	T	C	6: 52,191,540	H50R	unknown	Het
Htr7	T	C	19: 36,056,892	Y121C	probably damaging	Het
Ift43	G	A	12: 86,161,190	D111N	probably damaging	Het
Itih3	A	G	14: 30,908,765	V863A	probably damaging	Het
Macf1	T	C	4: 123,410,893		probably benign	Het
Mgat3	A	G	15: 80,210,992	K7E	probably damaging	Het
Ndst4	T	A	3: 125,570,787	V371E	probably damaging	Het
Npr1	T	G	3: 90,465,016	D163A	possibly damaging	Het
Nudt12	T	C	17: 59,006,594	I330V	probably benign	Het
Olfr434	T	G	6: 43,217,245	C111G	probably damaging	Het
Olfr630	C	A	7: 103,755,072	C171F	probably damaging	Het
Olfr730	T	A	14: 50,186,563	Y219F	probably damaging	Het
Olfr850	C	A	9: 19,477,832	M139I	possibly damaging	Het
Poc1a	A	T	9: 106,349,768	R402S	probably benign	Het
Prex2	G	T	1: 11,123,213	V470L	probably damaging	Het
Prom1	T	C	5: 44,063,127	E93G	probably damaging	Het
Psma1	A	T	7: 114,269,726	M180K	probably benign	Het
Pudp	A	T	18: 50,567,982	F227I	probably damaging	Het
Rab15	T	A	12: 76,804,449	Q60L	probably damaging	Het
Scaf8	T	C	17: 3,171,222		probably null	Het
Sept9	T	A	11: 117,290,662	I96N	probably damaging	Het
Sez6	T	C	11: 77,978,050	S976P	probably damaging	Het
Slc2a12	A	G	10: 22,664,903	Y219C	probably damaging	Het
Slc38a9	T	A	13: 112,695,355	I213K	probably damaging	Het
Stil	T	A	4: 115,023,808	D516E	probably benign	Het
Supt20	A	G	3: 54,707,122	D184G	probably damaging	Het
Tarsl2	G	A	7: 65,658,871	S263N	probably benign	Het
Tmem181a	C	A	17: 6,289,020	T68K	probably benign	Het
Trav21-dv12	G	T	14: 53,876,540	C39F	probably damaging	Het
Tshz1	T	C	18: 84,014,048	E745G	probably damaging	Het
Ugt1a8	T	A	1: 88,088,182	F106I	probably benign	Het
Vmn1r39	C	A	6: 66,804,444	V297L	probably benign	Het
Vmn2r101	G	A	17: 19,591,181		probably null	Het
Vmn2r69	GAAAA	GAAAAA	7: 85,411,560		probably null	Het

Other mutations in Col5a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Col5a3	APN	9	20786389	nonsense	probably null
IGL01548:Col5a3	APN	9	20803000	splice site	probably benign
IGL02164:Col5a3	APN	9	20792643	critical splice donor site	probably null
IGL02297:Col5a3	APN	9	20772154	missense	unknown
IGL02333:Col5a3	APN	9	20799306	missense	unknown
IGL02349:Col5a3	APN	9	20772361	missense	unknown
IGL02390:Col5a3	APN	9	20776996	missense	unknown
IGL02685:Col5a3	APN	9	20772205	missense	unknown
IGL02941:Col5a3	APN	9	20804666	missense	unknown
IGL03001:Col5a3	APN	9	20807744	missense	unknown
IGL03061:Col5a3	APN	9	20797572	critical splice donor site	probably null
IGL03102:Col5a3	APN	9	20804635	critical splice donor site	probably null
IGL03308:Col5a3	APN	9	20808379	missense	unknown
IGL03372:Col5a3	APN	9	20775328	missense	unknown
Guppy	UTSW	9	20779033	missense	probably damaging	1.00
minifish	UTSW	9	20785586	missense	probably damaging	0.99
R0002:Col5a3	UTSW	9	20809856	critical splice acceptor site	probably null
R0012:Col5a3	UTSW	9	20777108	splice site	probably benign
R0316:Col5a3	UTSW	9	20775325	missense	unknown
R0357:Col5a3	UTSW	9	20807768	splice site	probably benign
R0360:Col5a3	UTSW	9	20772466	missense	unknown
R0483:Col5a3	UTSW	9	20782481	splice site	probably null
R0485:Col5a3	UTSW	9	20782708	missense	probably damaging	0.99
R0627:Col5a3	UTSW	9	20775485	missense	unknown
R1035:Col5a3	UTSW	9	20793499	splice site	probably benign
R1051:Col5a3	UTSW	9	20775235	missense	unknown
R1295:Col5a3	UTSW	9	20808418	missense	unknown
R1438:Col5a3	UTSW	9	20779957	missense	probably damaging	0.99
R1622:Col5a3	UTSW	9	20772220	missense	unknown
R1668:Col5a3	UTSW	9	20771096	missense	unknown
R1680:Col5a3	UTSW	9	20784668	critical splice donor site	probably null
R2112:Col5a3	UTSW	9	20809777	missense	unknown
R2149:Col5a3	UTSW	9	20771270	missense	unknown
R2159:Col5a3	UTSW	9	20771310	missense	unknown
R2939:Col5a3	UTSW	9	20795658	missense	unknown
R3236:Col5a3	UTSW	9	20807653	missense	unknown
R3845:Col5a3	UTSW	9	20808377	missense	unknown
R4598:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4599:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4611:Col5a3	UTSW	9	20814896	unclassified	probably benign
R4713:Col5a3	UTSW	9	20793574	missense	unknown
R4723:Col5a3	UTSW	9	20809591	missense	unknown
R5209:Col5a3	UTSW	9	20778643	intron	probably benign
R5336:Col5a3	UTSW	9	20799301	missense	unknown
R5378:Col5a3	UTSW	9	20797576	missense	unknown
R5614:Col5a3	UTSW	9	20783476	splice site	probably benign
R5775:Col5a3	UTSW	9	20801072	missense	unknown
R5895:Col5a3	UTSW	9	20772442	missense	unknown
R6048:Col5a3	UTSW	9	20807619	missense	unknown
R6265:Col5a3	UTSW	9	20793764	missense	unknown
R6372:Col5a3	UTSW	9	20785586	missense	probably damaging	0.99
R6520:Col5a3	UTSW	9	20774052	missense	unknown
R6558:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6608:Col5a3	UTSW	9	20774019	missense	unknown
R6679:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6680:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6696:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6698:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6700:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6708:Col5a3	UTSW	9	20775035	missense	unknown
R6712:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6714:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6828:Col5a3	UTSW	9	20798452	missense	unknown
R7343:Col5a3	UTSW	9	20793946	critical splice donor site	probably null
R7431:Col5a3	UTSW	9	20770835	makesense	probably null
R7500:Col5a3	UTSW	9	20800289	missense	unknown
R7671:Col5a3	UTSW	9	20775086	critical splice acceptor site	probably null
R7957:Col5a3	UTSW	9	20774051	missense	unknown
R8510:Col5a3	UTSW	9	20793732	missense	unknown
R8979:Col5a3	UTSW	9	20775301	missense	unknown
R9050:Col5a3	UTSW	9	20786395	missense	probably damaging	1.00
R9052:Col5a3	UTSW	9	20799437	missense	unknown
R9072:Col5a3	UTSW	9	20771157	missense	unknown
R9341:Col5a3	UTSW	9	20793613	missense	unknown
R9343:Col5a3	UTSW	9	20793613	missense	unknown
R9529:Col5a3	UTSW	9	20774012	critical splice donor site	probably null
R9562:Col5a3	UTSW	9	20803133	missense	unknown
R9781:Col5a3	UTSW	9	20809976	missense	unknown
Z1177:Col5a3	UTSW	9	20775334	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCAAAGGAGCCCTAGAGTGG -3'
(R):5'- AACGTGGTAAGCGTCCTAC -3'

Sequencing Primer
(F):5'- TGGTGACAGAAGCAAGTCACTTACC -3'
(R):5'- GTGGTAAGCGTCCTACCATCTG -3'

Posted On

2019-10-24