Incidental Mutation 'R7592:Ankrd13b'
ID 587464
Institutional Source Beutler Lab
Gene Symbol Ankrd13b
Ensembl Gene ENSMUSG00000037907
Gene Name ankyrin repeat domain 13b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock # R7592 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 77470485-77489678 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 77476501 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 194 (V194G)
Ref Sequence ENSEMBL: ENSMUSP00000073584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037593] [ENSMUST00000092892] [ENSMUST00000145934]
AlphaFold Q5F259
Predicted Effect probably benign
Transcript: ENSMUST00000037593
AA Change: V194G

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073584
Gene: ENSMUSG00000037907
AA Change: V194G

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 491 5.5e-111 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 552 580 N/A INTRINSIC
UIM 585 604 3.15e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092892
AA Change: V194G

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090568
Gene: ENSMUSG00000037907
AA Change: V194G

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 490 3.2e-110 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127291
SMART Domains Protein: ENSMUSP00000118247
Gene: ENSMUSG00000037907

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 120 9.7e-31 PFAM
low complexity region 121 133 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145934
SMART Domains Protein: ENSMUSP00000119633
Gene: ENSMUSG00000037907

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 2 276 9.7e-90 PFAM
UIM 288 307 1.81e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,849,274 T204A unknown Het
Abca12 T C 1: 71,288,677 T1415A probably benign Het
Adamtsl3 A G 7: 82,337,251 T24A probably benign Het
Aurkc C T 7: 7,000,007 T167I probably benign Het
BC100530 A T 16: 36,367,500 M1K probably null Het
Capn1 T C 19: 6,014,439 Y10C probably benign Het
Ccnk T C 12: 108,186,465 S14P possibly damaging Het
Cebpe T A 14: 54,711,841 I40F probably damaging Het
Cers3 G A 7: 66,789,629 C296Y probably damaging Het
Cog8 A T 8: 107,050,229 C505S possibly damaging Het
Col4a3 A G 1: 82,648,617 I92V unknown Het
Col5a3 T A 9: 20,797,393 H645L unknown Het
Crispld1 A T 1: 17,728,766 E37V possibly damaging Het
Csmd2 A G 4: 128,463,798 Y1684C Het
Dcst1 C A 3: 89,353,292 S555I probably benign Het
Drc1 A G 5: 30,341,716 S70G possibly damaging Het
Elavl2 A T 4: 91,311,571 probably null Het
Emc1 A G 4: 139,360,566 H300R probably benign Het
Gcnt4 G A 13: 96,947,161 V322I probably benign Het
Gsg1l2 A G 11: 67,774,758 N51D probably benign Het
Gucy2e A T 11: 69,223,324 probably null Het
Hip1r A G 5: 123,997,973 E579G probably benign Het
Hoxa4 T C 6: 52,191,540 H50R unknown Het
Htr7 T C 19: 36,056,892 Y121C probably damaging Het
Ift43 G A 12: 86,161,190 D111N probably damaging Het
Itih3 A G 14: 30,908,765 V863A probably damaging Het
Macf1 T C 4: 123,410,893 probably benign Het
Mgat3 A G 15: 80,210,992 K7E probably damaging Het
Ndst4 T A 3: 125,570,787 V371E probably damaging Het
Npr1 T G 3: 90,465,016 D163A possibly damaging Het
Nudt12 T C 17: 59,006,594 I330V probably benign Het
Olfr434 T G 6: 43,217,245 C111G probably damaging Het
Olfr630 C A 7: 103,755,072 C171F probably damaging Het
Olfr730 T A 14: 50,186,563 Y219F probably damaging Het
Olfr850 C A 9: 19,477,832 M139I possibly damaging Het
Poc1a A T 9: 106,349,768 R402S probably benign Het
Prex2 G T 1: 11,123,213 V470L probably damaging Het
Prom1 T C 5: 44,063,127 E93G probably damaging Het
Psma1 A T 7: 114,269,726 M180K probably benign Het
Pudp A T 18: 50,567,982 F227I probably damaging Het
Rab15 T A 12: 76,804,449 Q60L probably damaging Het
Scaf8 T C 17: 3,171,222 probably null Het
Sept9 T A 11: 117,290,662 I96N probably damaging Het
Sez6 T C 11: 77,978,050 S976P probably damaging Het
Slc2a12 A G 10: 22,664,903 Y219C probably damaging Het
Slc38a9 T A 13: 112,695,355 I213K probably damaging Het
Stil T A 4: 115,023,808 D516E probably benign Het
Supt20 A G 3: 54,707,122 D184G probably damaging Het
Tarsl2 G A 7: 65,658,871 S263N probably benign Het
Tmem181a C A 17: 6,289,020 T68K probably benign Het
Trav21-dv12 G T 14: 53,876,540 C39F probably damaging Het
Tshz1 T C 18: 84,014,048 E745G probably damaging Het
Ugt1a8 T A 1: 88,088,182 F106I probably benign Het
Vmn1r39 C A 6: 66,804,444 V297L probably benign Het
Vmn2r101 G A 17: 19,591,181 probably null Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Other mutations in Ankrd13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ankrd13b APN 11 77472752 missense probably damaging 1.00
IGL01396:Ankrd13b APN 11 77472372 splice site probably null
IGL02731:Ankrd13b APN 11 77476219 missense probably damaging 0.99
R0310:Ankrd13b UTSW 11 77472745 missense possibly damaging 0.71
R0496:Ankrd13b UTSW 11 77473041 missense probably damaging 1.00
R0511:Ankrd13b UTSW 11 77473288 missense possibly damaging 0.89
R0831:Ankrd13b UTSW 11 77472759 missense probably damaging 0.99
R1156:Ankrd13b UTSW 11 77472861 missense probably damaging 1.00
R1237:Ankrd13b UTSW 11 77474574 missense probably damaging 1.00
R2259:Ankrd13b UTSW 11 77476342 missense probably damaging 1.00
R3110:Ankrd13b UTSW 11 77477505 missense possibly damaging 0.67
R3112:Ankrd13b UTSW 11 77477505 missense possibly damaging 0.67
R4190:Ankrd13b UTSW 11 77476375 missense probably damaging 1.00
R4471:Ankrd13b UTSW 11 77476214 missense probably damaging 1.00
R4599:Ankrd13b UTSW 11 77471668 missense probably benign
R5253:Ankrd13b UTSW 11 77473235 intron probably benign
R5677:Ankrd13b UTSW 11 77477544 missense probably damaging 0.99
R7073:Ankrd13b UTSW 11 77472509 missense probably benign 0.39
R7388:Ankrd13b UTSW 11 77472757 missense probably benign 0.02
R7417:Ankrd13b UTSW 11 77476194 missense probably damaging 0.97
R7596:Ankrd13b UTSW 11 77472314 missense probably benign 0.18
R7643:Ankrd13b UTSW 11 77473085 missense probably benign 0.01
R8434:Ankrd13b UTSW 11 77477726 missense probably benign 0.01
R8959:Ankrd13b UTSW 11 77476626 missense probably damaging 1.00
R9668:Ankrd13b UTSW 11 77477768 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGTGAAAGAATGGCCCATC -3'
(R):5'- ACCACGCTTTTGGGCTTTG -3'

Sequencing Primer
(F):5'- ATCGGGCTGGCTCCTGG -3'
(R):5'- TTGACCATATGACCTGGCAG -3'
Posted On 2019-10-24