Incidental Mutation 'R7592:Mgat3'
ID 587476
Institutional Source Beutler Lab
Gene Symbol Mgat3
Ensembl Gene ENSMUSG00000042428
Gene Name mannoside acetylglucosaminyltransferase 3
Synonyms GnT-III, 1110038J12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R7592 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 80173721-80215519 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80210992 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 7 (K7E)
Ref Sequence ENSEMBL: ENSMUSP00000043077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044970]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044970
AA Change: K7E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043077
Gene: ENSMUSG00000042428
AA Change: K7E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:Glyco_transf_17 191 362 3.2e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. The enzyme encoded by this gene transfers a GlcNAc residue to the beta-linked mannose of the trimannosyl core of N-linked oligosaccharides and produces a bisecting GlcNAc. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced DEN and PB-induced hepatic tumors and reduced hepatocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,849,274 T204A unknown Het
Abca12 T C 1: 71,288,677 T1415A probably benign Het
Adamtsl3 A G 7: 82,337,251 T24A probably benign Het
Ankrd13b A C 11: 77,476,501 V194G probably benign Het
Aurkc C T 7: 7,000,007 T167I probably benign Het
BC100530 A T 16: 36,367,500 M1K probably null Het
Capn1 T C 19: 6,014,439 Y10C probably benign Het
Ccnk T C 12: 108,186,465 S14P possibly damaging Het
Cebpe T A 14: 54,711,841 I40F probably damaging Het
Cers3 G A 7: 66,789,629 C296Y probably damaging Het
Cog8 A T 8: 107,050,229 C505S possibly damaging Het
Col4a3 A G 1: 82,648,617 I92V unknown Het
Col5a3 T A 9: 20,797,393 H645L unknown Het
Crispld1 A T 1: 17,728,766 E37V possibly damaging Het
Csmd2 A G 4: 128,463,798 Y1684C Het
Dcst1 C A 3: 89,353,292 S555I probably benign Het
Drc1 A G 5: 30,341,716 S70G possibly damaging Het
Elavl2 A T 4: 91,311,571 probably null Het
Emc1 A G 4: 139,360,566 H300R probably benign Het
Gcnt4 G A 13: 96,947,161 V322I probably benign Het
Gsg1l2 A G 11: 67,774,758 N51D probably benign Het
Gucy2e A T 11: 69,223,324 probably null Het
Hip1r A G 5: 123,997,973 E579G probably benign Het
Hoxa4 T C 6: 52,191,540 H50R unknown Het
Htr7 T C 19: 36,056,892 Y121C probably damaging Het
Ift43 G A 12: 86,161,190 D111N probably damaging Het
Itih3 A G 14: 30,908,765 V863A probably damaging Het
Macf1 T C 4: 123,410,893 probably benign Het
Ndst4 T A 3: 125,570,787 V371E probably damaging Het
Npr1 T G 3: 90,465,016 D163A possibly damaging Het
Nudt12 T C 17: 59,006,594 I330V probably benign Het
Olfr434 T G 6: 43,217,245 C111G probably damaging Het
Olfr630 C A 7: 103,755,072 C171F probably damaging Het
Olfr730 T A 14: 50,186,563 Y219F probably damaging Het
Olfr850 C A 9: 19,477,832 M139I possibly damaging Het
Poc1a A T 9: 106,349,768 R402S probably benign Het
Prex2 G T 1: 11,123,213 V470L probably damaging Het
Prom1 T C 5: 44,063,127 E93G probably damaging Het
Psma1 A T 7: 114,269,726 M180K probably benign Het
Pudp A T 18: 50,567,982 F227I probably damaging Het
Rab15 T A 12: 76,804,449 Q60L probably damaging Het
Scaf8 T C 17: 3,171,222 probably null Het
Sept9 T A 11: 117,290,662 I96N probably damaging Het
Sez6 T C 11: 77,978,050 S976P probably damaging Het
Slc2a12 A G 10: 22,664,903 Y219C probably damaging Het
Slc38a9 T A 13: 112,695,355 I213K probably damaging Het
Stil T A 4: 115,023,808 D516E probably benign Het
Supt20 A G 3: 54,707,122 D184G probably damaging Het
Tarsl2 G A 7: 65,658,871 S263N probably benign Het
Tmem181a C A 17: 6,289,020 T68K probably benign Het
Trav21-dv12 G T 14: 53,876,540 C39F probably damaging Het
Tshz1 T C 18: 84,014,048 E745G probably damaging Het
Ugt1a8 T A 1: 88,088,182 F106I probably benign Het
Vmn1r39 C A 6: 66,804,444 V297L probably benign Het
Vmn2r101 G A 17: 19,591,181 probably null Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Other mutations in Mgat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Mgat3 APN 15 80212433 missense probably damaging 1.00
IGL01134:Mgat3 APN 15 80212176 missense probably benign 0.17
R0077:Mgat3 UTSW 15 80212577 missense probably benign 0.00
R1171:Mgat3 UTSW 15 80211637 missense probably benign 0.26
R1885:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1886:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1986:Mgat3 UTSW 15 80212189 missense probably benign 0.04
R2125:Mgat3 UTSW 15 80211886 missense probably benign 0.00
R3081:Mgat3 UTSW 15 80211854 missense probably benign 0.33
R4819:Mgat3 UTSW 15 80212349 missense probably damaging 1.00
R4992:Mgat3 UTSW 15 80212542 missense probably benign
R5083:Mgat3 UTSW 15 80211298 missense possibly damaging 0.92
R5356:Mgat3 UTSW 15 80211610 missense possibly damaging 0.88
R5356:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R6508:Mgat3 UTSW 15 80212024 missense possibly damaging 0.90
R6784:Mgat3 UTSW 15 80212200 missense probably damaging 0.98
R7021:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R7056:Mgat3 UTSW 15 80211896 missense probably damaging 0.99
R7774:Mgat3 UTSW 15 80211542 missense probably damaging 0.96
R7819:Mgat3 UTSW 15 80211772 nonsense probably null
R8559:Mgat3 UTSW 15 80212169 missense probably damaging 1.00
R8678:Mgat3 UTSW 15 80212271 missense possibly damaging 0.74
R9285:Mgat3 UTSW 15 80212337 missense probably damaging 1.00
R9483:Mgat3 UTSW 15 80211440 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCTGGTGGAGGAACAGAC -3'
(R):5'- TAGAGGGGTGTCCGCAATAG -3'

Sequencing Primer
(F):5'- CTTCTGGTGGAGGAACAGACTTCAG -3'
(R):5'- TGTCCGCAATAGGTCGGG -3'
Posted On 2019-10-24