Incidental Mutation 'R7592:Tshz1'
ID 587483
Institutional Source Beutler Lab
Gene Symbol Tshz1
Ensembl Gene ENSMUSG00000046982
Gene Name teashirt zinc finger family member 1
Synonyms Mtsh1, teashirt1, Sdccag33, D18Bwg1409e, Tsh1, NY-CO-33, 5730407I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7592 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 84011627-84086404 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84014048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 745 (E745G)
Ref Sequence ENSEMBL: ENSMUSP00000089388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060303]
AlphaFold Q5DTH5
Predicted Effect probably damaging
Transcript: ENSMUST00000060303
AA Change: E745G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089388
Gene: ENSMUSG00000046982
AA Change: E745G

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 153 195 N/A INTRINSIC
ZnF_C2H2 246 270 1.86e0 SMART
ZnF_C2H2 307 331 3.83e-2 SMART
ZnF_C2H2 416 440 5.34e0 SMART
low complexity region 497 515 N/A INTRINSIC
HOX 890 964 4.15e-4 SMART
ZnF_C2H2 976 998 4.34e-1 SMART
ZnF_C2H2 1044 1067 4.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer antigen that was defined by serological analysis of recombinant cDNA expression libraries. The encoded protein is a member of the teashirt C2H2-type zinc-finger protein family and may be involved in transcriptional regulation of developmental processes. Mutations in this gene may be associated with congenital aural atresia syndrome. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele die shortly after birth of respiratory distress, have defects in soft palate formation, have altered axial skeleton and have middle ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,849,274 T204A unknown Het
Abca12 T C 1: 71,288,677 T1415A probably benign Het
Adamtsl3 A G 7: 82,337,251 T24A probably benign Het
Ankrd13b A C 11: 77,476,501 V194G probably benign Het
Aurkc C T 7: 7,000,007 T167I probably benign Het
BC100530 A T 16: 36,367,500 M1K probably null Het
Capn1 T C 19: 6,014,439 Y10C probably benign Het
Ccnk T C 12: 108,186,465 S14P possibly damaging Het
Cebpe T A 14: 54,711,841 I40F probably damaging Het
Cers3 G A 7: 66,789,629 C296Y probably damaging Het
Cog8 A T 8: 107,050,229 C505S possibly damaging Het
Col4a3 A G 1: 82,648,617 I92V unknown Het
Col5a3 T A 9: 20,797,393 H645L unknown Het
Crispld1 A T 1: 17,728,766 E37V possibly damaging Het
Csmd2 A G 4: 128,463,798 Y1684C Het
Dcst1 C A 3: 89,353,292 S555I probably benign Het
Drc1 A G 5: 30,341,716 S70G possibly damaging Het
Elavl2 A T 4: 91,311,571 probably null Het
Emc1 A G 4: 139,360,566 H300R probably benign Het
Gcnt4 G A 13: 96,947,161 V322I probably benign Het
Gsg1l2 A G 11: 67,774,758 N51D probably benign Het
Gucy2e A T 11: 69,223,324 probably null Het
Hip1r A G 5: 123,997,973 E579G probably benign Het
Hoxa4 T C 6: 52,191,540 H50R unknown Het
Htr7 T C 19: 36,056,892 Y121C probably damaging Het
Ift43 G A 12: 86,161,190 D111N probably damaging Het
Itih3 A G 14: 30,908,765 V863A probably damaging Het
Macf1 T C 4: 123,410,893 probably benign Het
Mgat3 A G 15: 80,210,992 K7E probably damaging Het
Ndst4 T A 3: 125,570,787 V371E probably damaging Het
Npr1 T G 3: 90,465,016 D163A possibly damaging Het
Nudt12 T C 17: 59,006,594 I330V probably benign Het
Olfr434 T G 6: 43,217,245 C111G probably damaging Het
Olfr630 C A 7: 103,755,072 C171F probably damaging Het
Olfr730 T A 14: 50,186,563 Y219F probably damaging Het
Olfr850 C A 9: 19,477,832 M139I possibly damaging Het
Poc1a A T 9: 106,349,768 R402S probably benign Het
Prex2 G T 1: 11,123,213 V470L probably damaging Het
Prom1 T C 5: 44,063,127 E93G probably damaging Het
Psma1 A T 7: 114,269,726 M180K probably benign Het
Pudp A T 18: 50,567,982 F227I probably damaging Het
Rab15 T A 12: 76,804,449 Q60L probably damaging Het
Scaf8 T C 17: 3,171,222 probably null Het
Sept9 T A 11: 117,290,662 I96N probably damaging Het
Sez6 T C 11: 77,978,050 S976P probably damaging Het
Slc2a12 A G 10: 22,664,903 Y219C probably damaging Het
Slc38a9 T A 13: 112,695,355 I213K probably damaging Het
Stil T A 4: 115,023,808 D516E probably benign Het
Supt20 A G 3: 54,707,122 D184G probably damaging Het
Tarsl2 G A 7: 65,658,871 S263N probably benign Het
Tmem181a C A 17: 6,289,020 T68K probably benign Het
Trav21-dv12 G T 14: 53,876,540 C39F probably damaging Het
Ugt1a8 T A 1: 88,088,182 F106I probably benign Het
Vmn1r39 C A 6: 66,804,444 V297L probably benign Het
Vmn2r101 G A 17: 19,591,181 probably null Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Other mutations in Tshz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Tshz1 APN 18 84013509 missense possibly damaging 0.94
IGL02934:Tshz1 APN 18 84013090 missense probably damaging 1.00
ANU18:Tshz1 UTSW 18 84014661 missense probably damaging 1.00
PIT4810001:Tshz1 UTSW 18 84013250 missense possibly damaging 0.85
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0364:Tshz1 UTSW 18 84016124 missense probably benign 0.31
R0391:Tshz1 UTSW 18 84016049 missense possibly damaging 0.93
R0515:Tshz1 UTSW 18 84015965 missense probably benign
R0942:Tshz1 UTSW 18 84013053 missense probably damaging 0.99
R0943:Tshz1 UTSW 18 84015231 missense probably benign 0.04
R1472:Tshz1 UTSW 18 84013805 missense possibly damaging 0.93
R1895:Tshz1 UTSW 18 84013433 missense probably damaging 1.00
R2022:Tshz1 UTSW 18 84013862 missense probably damaging 0.98
R2860:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R2861:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R4027:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4028:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4030:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4031:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4119:Tshz1 UTSW 18 84014189 missense probably benign 0.00
R4233:Tshz1 UTSW 18 84016195 missense probably benign 0.00
R4573:Tshz1 UTSW 18 84015082 missense probably damaging 1.00
R4604:Tshz1 UTSW 18 84013374 missense probably damaging 1.00
R4960:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R5085:Tshz1 UTSW 18 84013928 missense probably benign 0.01
R5124:Tshz1 UTSW 18 84015467 missense probably damaging 1.00
R5150:Tshz1 UTSW 18 84013215 nonsense probably null
R5357:Tshz1 UTSW 18 84015080 missense probably damaging 1.00
R5530:Tshz1 UTSW 18 84013268 missense probably damaging 1.00
R5718:Tshz1 UTSW 18 84014524 missense probably damaging 1.00
R5750:Tshz1 UTSW 18 84013961 missense possibly damaging 0.93
R5778:Tshz1 UTSW 18 84015680 missense probably damaging 1.00
R6052:Tshz1 UTSW 18 84014069 missense probably damaging 1.00
R6279:Tshz1 UTSW 18 84015311 missense probably damaging 1.00
R6393:Tshz1 UTSW 18 84013220 missense probably damaging 1.00
R6407:Tshz1 UTSW 18 84015966 missense possibly damaging 0.55
R6425:Tshz1 UTSW 18 84015563 missense probably damaging 0.99
R6998:Tshz1 UTSW 18 84015841 missense probably benign 0.00
R7165:Tshz1 UTSW 18 84015927 missense probably damaging 1.00
R7233:Tshz1 UTSW 18 84014819 missense possibly damaging 0.63
R7330:Tshz1 UTSW 18 84014831 missense probably damaging 0.96
R7491:Tshz1 UTSW 18 84015641 missense probably damaging 1.00
R7579:Tshz1 UTSW 18 84014665 nonsense probably null
R7659:Tshz1 UTSW 18 84016075 missense probably damaging 0.97
R7702:Tshz1 UTSW 18 84014336 missense probably damaging 1.00
R7844:Tshz1 UTSW 18 84014171 missense probably benign 0.00
R7908:Tshz1 UTSW 18 84014607 nonsense probably null
R7941:Tshz1 UTSW 18 84015392 missense possibly damaging 0.91
R7947:Tshz1 UTSW 18 84015657 missense probably damaging 1.00
R8435:Tshz1 UTSW 18 84014024 missense probably damaging 1.00
R8750:Tshz1 UTSW 18 84015037 missense probably damaging 1.00
R8774:Tshz1 UTSW 18 84014976 missense possibly damaging 0.96
R8774-TAIL:Tshz1 UTSW 18 84014976 missense possibly damaging 0.96
R9029:Tshz1 UTSW 18 84013514 missense probably damaging 0.98
R9031:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R9573:Tshz1 UTSW 18 84014279 missense probably benign 0.45
R9584:Tshz1 UTSW 18 84014964 missense probably damaging 1.00
R9596:Tshz1 UTSW 18 84013779 missense possibly damaging 0.92
R9701:Tshz1 UTSW 18 84014454 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGATCAATGGGCTGGTCG -3'
(R):5'- TCTTCCTAAGACAGAGGAGACC -3'

Sequencing Primer
(F):5'- TAGCGGTCGATTGCATCAGC -3'
(R):5'- AGACCGGGAGCAAGCCAC -3'
Posted On 2019-10-24