Incidental Mutation 'R7592:Capn1'
ID 587484
Institutional Source Beutler Lab
Gene Symbol Capn1
Ensembl Gene ENSMUSG00000024942
Gene Name calpain 1
Synonyms Capa1, Capa-1, mu-calpin
MMRRC Submission 045639-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7592 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 6038573-6065855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6064469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 10 (Y10C)
Ref Sequence ENSEMBL: ENSMUSP00000025891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000164843]
AlphaFold O35350
Predicted Effect probably benign
Transcript: ENSMUST00000025891
AA Change: Y10C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942
AA Change: Y10C

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164843
AA Change: Y10C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942
AA Change: Y10C

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a mutation of this gene exhibit decreased platelet aggregation and defective clot retraction although bleeding times remain similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,667,138 (GRCm39) T204A unknown Het
Abca12 T C 1: 71,327,836 (GRCm39) T1415A probably benign Het
Adamtsl3 A G 7: 81,986,459 (GRCm39) T24A probably benign Het
Ankrd13b A C 11: 77,367,327 (GRCm39) V194G probably benign Het
Aurkc C T 7: 7,003,006 (GRCm39) T167I probably benign Het
Ccnk T C 12: 108,152,724 (GRCm39) S14P possibly damaging Het
Cebpe T A 14: 54,949,298 (GRCm39) I40F probably damaging Het
Cers3 G A 7: 66,439,377 (GRCm39) C296Y probably damaging Het
Cog8 A T 8: 107,776,861 (GRCm39) C505S possibly damaging Het
Col4a3 A G 1: 82,626,338 (GRCm39) I92V unknown Het
Col5a3 T A 9: 20,708,689 (GRCm39) H645L unknown Het
Crispld1 A T 1: 17,798,990 (GRCm39) E37V possibly damaging Het
Csmd2 A G 4: 128,357,591 (GRCm39) Y1684C Het
Cstdc5 A T 16: 36,187,862 (GRCm39) M1K probably null Het
Dcst1 C A 3: 89,260,599 (GRCm39) S555I probably benign Het
Drc1 A G 5: 30,499,060 (GRCm39) S70G possibly damaging Het
Elavl2 A T 4: 91,199,808 (GRCm39) probably null Het
Emc1 A G 4: 139,087,877 (GRCm39) H300R probably benign Het
Gcnt4 G A 13: 97,083,669 (GRCm39) V322I probably benign Het
Gsg1l2 A G 11: 67,665,584 (GRCm39) N51D probably benign Het
Gucy2e A T 11: 69,114,150 (GRCm39) probably null Het
Hip1r A G 5: 124,136,036 (GRCm39) E579G probably benign Het
Hoxa4 T C 6: 52,168,520 (GRCm39) H50R unknown Het
Htr7 T C 19: 36,034,292 (GRCm39) Y121C probably damaging Het
Ift43 G A 12: 86,207,964 (GRCm39) D111N probably damaging Het
Itih3 A G 14: 30,630,722 (GRCm39) V863A probably damaging Het
Macf1 T C 4: 123,304,686 (GRCm39) probably benign Het
Mgat3 A G 15: 80,095,193 (GRCm39) K7E probably damaging Het
Ndst4 T A 3: 125,364,436 (GRCm39) V371E probably damaging Het
Npr1 T G 3: 90,372,323 (GRCm39) D163A possibly damaging Het
Nudt12 T C 17: 59,313,589 (GRCm39) I330V probably benign Het
Or2a20 T G 6: 43,194,179 (GRCm39) C111G probably damaging Het
Or4k2 T A 14: 50,424,020 (GRCm39) Y219F probably damaging Het
Or51l4 C A 7: 103,404,279 (GRCm39) C171F probably damaging Het
Or7g32 C A 9: 19,389,128 (GRCm39) M139I possibly damaging Het
Poc1a A T 9: 106,226,967 (GRCm39) R402S probably benign Het
Prex2 G T 1: 11,193,437 (GRCm39) V470L probably damaging Het
Prom1 T C 5: 44,220,469 (GRCm39) E93G probably damaging Het
Psma1 A T 7: 113,868,961 (GRCm39) M180K probably benign Het
Pudp A T 18: 50,701,053 (GRCm39) F227I probably damaging Het
Rab15 T A 12: 76,851,223 (GRCm39) Q60L probably damaging Het
Scaf8 T C 17: 3,221,497 (GRCm39) probably null Het
Septin9 T A 11: 117,181,488 (GRCm39) I96N probably damaging Het
Sez6 T C 11: 77,868,876 (GRCm39) S976P probably damaging Het
Slc2a12 A G 10: 22,540,802 (GRCm39) Y219C probably damaging Het
Slc38a9 T A 13: 112,831,889 (GRCm39) I213K probably damaging Het
Stil T A 4: 114,881,005 (GRCm39) D516E probably benign Het
Supt20 A G 3: 54,614,543 (GRCm39) D184G probably damaging Het
Tars3 G A 7: 65,308,619 (GRCm39) S263N probably benign Het
Tmem181a C A 17: 6,339,295 (GRCm39) T68K probably benign Het
Trav21-dv12 G T 14: 54,113,997 (GRCm39) C39F probably damaging Het
Tshz1 T C 18: 84,032,173 (GRCm39) E745G probably damaging Het
Ugt1a8 T A 1: 88,015,904 (GRCm39) F106I probably benign Het
Vmn1r39 C A 6: 66,781,428 (GRCm39) V297L probably benign Het
Vmn2r101 G A 17: 19,811,443 (GRCm39) probably null Het
Vmn2r69 GAAAA GAAAAA 7: 85,060,768 (GRCm39) probably null Het
Other mutations in Capn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Capn1 APN 19 6,057,299 (GRCm39) missense probably damaging 1.00
IGL01314:Capn1 APN 19 6,040,014 (GRCm39) splice site probably benign
R0044:Capn1 UTSW 19 6,064,373 (GRCm39) missense probably benign 0.03
R1496:Capn1 UTSW 19 6,057,528 (GRCm39) critical splice donor site probably null
R1646:Capn1 UTSW 19 6,047,760 (GRCm39) missense probably benign
R1852:Capn1 UTSW 19 6,059,133 (GRCm39) missense possibly damaging 0.95
R1924:Capn1 UTSW 19 6,040,086 (GRCm39) splice site probably null
R2006:Capn1 UTSW 19 6,041,613 (GRCm39) missense probably damaging 1.00
R2109:Capn1 UTSW 19 6,064,388 (GRCm39) missense probably benign 0.01
R3704:Capn1 UTSW 19 6,057,401 (GRCm39) missense probably damaging 1.00
R3705:Capn1 UTSW 19 6,057,401 (GRCm39) missense probably damaging 1.00
R3830:Capn1 UTSW 19 6,044,877 (GRCm39) missense probably damaging 1.00
R4664:Capn1 UTSW 19 6,061,045 (GRCm39) missense probably benign 0.03
R4665:Capn1 UTSW 19 6,061,045 (GRCm39) missense probably benign 0.03
R4666:Capn1 UTSW 19 6,061,045 (GRCm39) missense probably benign 0.03
R4694:Capn1 UTSW 19 6,044,761 (GRCm39) nonsense probably null
R4745:Capn1 UTSW 19 6,043,946 (GRCm39) missense probably benign 0.12
R5103:Capn1 UTSW 19 6,059,140 (GRCm39) missense probably damaging 1.00
R5149:Capn1 UTSW 19 6,040,364 (GRCm39) splice site probably null
R5569:Capn1 UTSW 19 6,063,690 (GRCm39) missense probably benign
R5636:Capn1 UTSW 19 6,064,472 (GRCm39) missense probably benign 0.22
R5906:Capn1 UTSW 19 6,061,451 (GRCm39) missense possibly damaging 0.90
R5907:Capn1 UTSW 19 6,047,827 (GRCm39) missense probably benign
R7038:Capn1 UTSW 19 6,064,349 (GRCm39) missense probably benign 0.23
R7091:Capn1 UTSW 19 6,041,586 (GRCm39) missense possibly damaging 0.64
R7307:Capn1 UTSW 19 6,043,938 (GRCm39) missense possibly damaging 0.91
R7779:Capn1 UTSW 19 6,044,116 (GRCm39) missense probably benign
R8514:Capn1 UTSW 19 6,047,854 (GRCm39) missense probably damaging 0.98
R8708:Capn1 UTSW 19 6,061,328 (GRCm39) missense probably damaging 1.00
R9452:Capn1 UTSW 19 6,057,287 (GRCm39) missense probably damaging 1.00
Z1176:Capn1 UTSW 19 6,064,308 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGAGGACCCAGTTCCTTG -3'
(R):5'- CCCCTTTCCAGATTCTGAGAGC -3'

Sequencing Primer
(F):5'- AGGACCCAGTTCCTTGAAGCC -3'
(R):5'- TTCCAGATTCTGAGAGCCTAAC -3'
Posted On 2019-10-24