Incidental Mutation 'R7593:Erbb4'
ID587488
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7593 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68254599 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 711 (R711L)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect probably damaging
Transcript: ENSMUST00000119142
AA Change: R711L

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: R711L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: R711L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: R711L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153432
AA Change: R701L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: R701L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C T 5: 63,898,431 A170V probably damaging Het
Acp6 A T 3: 97,165,950 E102D probably benign Het
Acss1 T A 2: 150,619,768 R632* probably null Het
Adamtsl1 G T 4: 86,341,213 C832F probably damaging Het
Adgrg6 T G 10: 14,468,829 M127L probably damaging Het
Alkbh1 A T 12: 87,440,325 Y91* probably null Het
Arhgap35 A T 7: 16,564,861 I93N probably damaging Het
Asic2 A T 11: 81,967,831 D118E probably benign Het
Asprv1 G T 6: 86,628,780 V203L probably damaging Het
Atad2b G A 12: 5,031,726 D1212N probably benign Het
Atp4a A G 7: 30,724,680 I960V probably benign Het
Bin1 G T 18: 32,419,879 E186* probably null Het
Bmp10 A G 6: 87,433,669 Y148C probably damaging Het
Ccdc152 T A 15: 3,280,655 D246V probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cdh9 A T 15: 16,823,175 D81V probably damaging Het
Cep162 A T 9: 87,204,197 S1025T probably benign Het
Cidea A G 18: 67,360,213 I101V probably benign Het
Clock G A 5: 76,236,298 S478L possibly damaging Het
Cp T A 3: 19,966,330 N162K probably benign Het
Crb1 C T 1: 139,237,240 E1110K probably damaging Het
Cyp2b13 A T 7: 26,080,991 I146L possibly damaging Het
D630045J12Rik A G 6: 38,195,494 S580P possibly damaging Het
Dars2 T C 1: 161,057,543 E224G probably damaging Het
Dcbld2 A G 16: 58,424,578 T72A possibly damaging Het
Ddx11 A T 17: 66,126,198 I8F possibly damaging Het
Dennd2d T C 3: 106,499,928 F432L probably damaging Het
Dnah10 T C 5: 124,746,544 V543A probably benign Het
Eef2k G A 7: 120,889,268 probably null Het
Elmo1 A G 13: 20,290,440 M345V probably benign Het
Ephb4 A G 5: 137,361,298 M377V probably benign Het
Fads1 A G 19: 10,184,997 E95G probably damaging Het
Farsa G A 8: 84,867,649 probably null Het
Galntl6 A G 8: 57,777,259 S42P probably damaging Het
Gga2 G A 7: 121,990,449 T559M probably benign Het
Glipr1l2 G A 10: 112,092,560 G120D probably damaging Het
Gm14226 A T 2: 155,024,194 I24L unknown Het
Gprc5b G T 7: 118,984,269 R126S probably damaging Het
Gys1 A G 7: 45,442,936 D321G probably damaging Het
Hdlbp C T 1: 93,430,283 A299T probably benign Het
Hic2 A G 16: 17,259,115 T603A probably damaging Het
Hoxa11 A T 6: 52,243,544 I253N probably damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Inpp5d T A 1: 87,717,778 S1023T possibly damaging Het
Kif21a C T 15: 90,943,861 A1233T probably benign Het
Kif9 A T 9: 110,521,353 T771S possibly damaging Het
Klre1 T A 6: 129,583,187 C141S probably damaging Het
Lats1 A G 10: 7,701,712 Y200C probably damaging Het
Lgr4 T A 2: 109,999,456 L247H probably damaging Het
Lrrc37a T C 11: 103,500,952 K1216E probably benign Het
Lrrc41 G A 4: 116,092,944 R518H possibly damaging Het
Lrrk1 A G 7: 66,308,691 V320A probably benign Het
Mcm9 C T 10: 53,629,992 R62H probably benign Het
Mmp10 T G 9: 7,503,153 L38R probably damaging Het
Mroh8 A G 2: 157,229,947 L546P probably damaging Het
Myt1 T A 2: 181,797,739 D393E possibly damaging Het
Mzb1 A T 18: 35,647,848 I129N probably damaging Het
Nek10 A G 14: 14,826,955 D51G probably benign Het
Nme5 A G 18: 34,567,148 I148T probably benign Het
Nr2e1 G A 10: 42,563,479 P348L probably damaging Het
Nrp2 A G 1: 62,719,044 E63G probably damaging Het
Olfr594 A G 7: 103,220,264 E182G probably damaging Het
Olfr613 A T 7: 103,551,749 probably benign Het
Olfr678 A G 7: 105,069,497 H10R probably benign Het
Olfr679 A G 7: 105,086,165 T150A probably benign Het
Olfr715 A T 7: 107,128,575 S273T probably damaging Het
Pak7 A G 2: 136,100,964 S419P probably benign Het
Pfas C A 11: 68,991,095 M25I Het
Prdm9 A G 17: 15,544,605 S638P possibly damaging Het
Psd G A 19: 46,312,913 T954I possibly damaging Het
Psph T C 5: 129,787,273 probably benign Het
Ptprf A G 4: 118,212,396 I1517T probably benign Het
Rassf8 A G 6: 145,815,403 R152G probably benign Het
Rfx3 G A 19: 27,849,739 T149I probably benign Het
Rfx8 A T 1: 39,683,678 F260I probably damaging Het
Rnft1 C T 11: 86,493,197 Q308* probably null Het
Rock2 A G 12: 16,958,240 N528S probably benign Het
Rpp25l T C 4: 41,712,305 R157G unknown Het
Ryr1 A T 7: 29,036,103 N4083K probably damaging Het
Scd1 G T 19: 44,400,300 T237N probably benign Het
Sema3d T C 5: 12,508,145 F215L probably benign Het
Sema7a C T 9: 57,960,575 T478I probably benign Het
Sftpc T C 14: 70,522,183 T99A possibly damaging Het
Slc25a4 G A 8: 46,209,204 T139I probably damaging Het
Snx27 T C 3: 94,502,965 E468G possibly damaging Het
Snx33 T C 9: 56,926,774 K4E possibly damaging Het
Soat1 A T 1: 156,440,578 L253* probably null Het
Soga1 A T 2: 157,040,856 D425E probably benign Het
Sycp2l A T 13: 41,172,716 N749I probably damaging Het
Synj2bp A T 12: 81,510,890 I47N probably damaging Het
Tmem82 T A 4: 141,616,294 I222F probably damaging Het
Ube2o A T 11: 116,581,079 L112Q possibly damaging Het
Vmn1r204 G A 13: 22,556,584 W128* probably null Het
Vmn2r114 A T 17: 23,291,843 Y554* probably null Het
Vmn2r62 A T 7: 42,787,789 Y424N possibly damaging Het
Vmn2r70 A T 7: 85,566,104 L74* probably null Het
Vmp1 T A 11: 86,586,551 Y341F probably benign Het
Vps13a A T 19: 16,725,663 V642D probably damaging Het
Vps33a T C 5: 123,536,556 M383V probably benign Het
Vwf G A 6: 125,647,768 V1827I Het
Zc3hav1 A G 6: 38,329,186 Y644H probably benign Het
Zfp429 A C 13: 67,390,291 C345G probably damaging Het
Zfp595 T C 13: 67,316,759 H483R probably benign Het
Zfp748 G T 13: 67,542,519 H207Q probably benign Het
Zfp758 T C 17: 22,374,958 S142P probably damaging Het
Znfx1 A C 2: 167,056,225 S260A probably benign Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
tag UTSW 1 68250580 missense possibly damaging 0.67
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAACTTCTCAGCACTACTAAGGATTG -3'
(R):5'- TGGGGCTGTGGCAAATATTC -3'

Sequencing Primer
(F):5'- TTATGGAGCAGAGAACTACCTCGTC -3'
(R):5'- GCTGTGGCAAATATTCAGTGG -3'
Posted On2019-10-24