Mutagenetix > Incidental Mutations

Incidental Mutation 'R7593:Inpp5d'

587489

Institutional Source

Beutler Lab

Gene Symbol

Inpp5d

Ensembl Gene

ENSMUSG00000026288

Gene Name

inositol polyphosphate-5-phosphatase D

Synonyms

s-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.841) question?

Stock #

R7593 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87620312-87720507 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 87717778 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1023 (S1023T)

Ref Sequence

ENSEMBL: ENSMUSP00000127941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042275
AA Change: S1022T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: S1022T

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	954	979	N/A	INTRINSIC
low complexity region	1045	1057	N/A	INTRINSIC
low complexity region	1119	1131	N/A	INTRINSIC
low complexity region	1139	1148	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000072999

SMART Domains

Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	932	953	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167032
AA Change: S760T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: S760T

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	692	717	N/A	INTRINSIC
low complexity region	783	795	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168783
AA Change: S962T

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: S962T

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	4.5e-104	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1059	1071	N/A	INTRINSIC
low complexity region	1079	1088	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169754
AA Change: S1023T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: S1023T

Domain	Start	End	E-Value	Type
SH2	6	95	4.6e-31	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	2.2e-106	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	955	980	N/A	INTRINSIC
low complexity region	1046	1058	N/A	INTRINSIC
low complexity region	1120	1132	N/A	INTRINSIC
low complexity region	1140	1149	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170300
AA Change: S699T

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: S699T

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	796	808	N/A	INTRINSIC
low complexity region	816	825	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	T	5: 63,898,431	A170V	probably damaging	Het
Acp6	A	T	3: 97,165,950	E102D	probably benign	Het
Acss1	T	A	2: 150,619,768	R632*	probably null	Het
Adamtsl1	G	T	4: 86,341,213	C832F	probably damaging	Het
Adgrg6	T	G	10: 14,468,829	M127L	probably damaging	Het
Alkbh1	A	T	12: 87,440,325	Y91*	probably null	Het
Arhgap35	A	T	7: 16,564,861	I93N	probably damaging	Het
Asic2	A	T	11: 81,967,831	D118E	probably benign	Het
Asprv1	G	T	6: 86,628,780	V203L	probably damaging	Het
Atad2b	G	A	12: 5,031,726	D1212N	probably benign	Het
Atp4a	A	G	7: 30,724,680	I960V	probably benign	Het
Bin1	G	T	18: 32,419,879	E186*	probably null	Het
Bmp10	A	G	6: 87,433,669	Y148C	probably damaging	Het
Ccdc152	T	A	15: 3,280,655	D246V	probably damaging	Het
Cdc16	A	G	8: 13,777,605	T504A	probably benign	Het
Cdh9	A	T	15: 16,823,175	D81V	probably damaging	Het
Cep162	A	T	9: 87,204,197	S1025T	probably benign	Het
Cidea	A	G	18: 67,360,213	I101V	probably benign	Het
Clock	G	A	5: 76,236,298	S478L	possibly damaging	Het
Cp	T	A	3: 19,966,330	N162K	probably benign	Het
Crb1	C	T	1: 139,237,240	E1110K	probably damaging	Het
Cyp2b13	A	T	7: 26,080,991	I146L	possibly damaging	Het
D630045J12Rik	A	G	6: 38,195,494	S580P	possibly damaging	Het
Dars2	T	C	1: 161,057,543	E224G	probably damaging	Het
Dcbld2	A	G	16: 58,424,578	T72A	possibly damaging	Het
Ddx11	A	T	17: 66,126,198	I8F	possibly damaging	Het
Dennd2d	T	C	3: 106,499,928	F432L	probably damaging	Het
Dnah10	T	C	5: 124,746,544	V543A	probably benign	Het
Eef2k	G	A	7: 120,889,268		probably null	Het
Elmo1	A	G	13: 20,290,440	M345V	probably benign	Het
Ephb4	A	G	5: 137,361,298	M377V	probably benign	Het
Erbb4	C	A	1: 68,254,599	R711L	probably damaging	Het
Fads1	A	G	19: 10,184,997	E95G	probably damaging	Het
Farsa	G	A	8: 84,867,649		probably null	Het
Galntl6	A	G	8: 57,777,259	S42P	probably damaging	Het
Gga2	G	A	7: 121,990,449	T559M	probably benign	Het
Glipr1l2	G	A	10: 112,092,560	G120D	probably damaging	Het
Gm14226	A	T	2: 155,024,194	I24L	unknown	Het
Gprc5b	G	T	7: 118,984,269	R126S	probably damaging	Het
Gys1	A	G	7: 45,442,936	D321G	probably damaging	Het
Hdlbp	C	T	1: 93,430,283	A299T	probably benign	Het
Hic2	A	G	16: 17,259,115	T603A	probably damaging	Het
Hoxa11	A	T	6: 52,243,544	I253N	probably damaging	Het
Iglon5	A	T	7: 43,476,640	D222E	probably benign	Het
Kif21a	C	T	15: 90,943,861	A1233T	probably benign	Het
Kif9	A	T	9: 110,521,353	T771S	possibly damaging	Het
Klre1	T	A	6: 129,583,187	C141S	probably damaging	Het
Lats1	A	G	10: 7,701,712	Y200C	probably damaging	Het
Lgr4	T	A	2: 109,999,456	L247H	probably damaging	Het
Lrrc37a	T	C	11: 103,500,952	K1216E	probably benign	Het
Lrrc41	G	A	4: 116,092,944	R518H	possibly damaging	Het
Lrrk1	A	G	7: 66,308,691	V320A	probably benign	Het
Mcm9	C	T	10: 53,629,992	R62H	probably benign	Het
Mmp10	T	G	9: 7,503,153	L38R	probably damaging	Het
Mroh8	A	G	2: 157,229,947	L546P	probably damaging	Het
Myt1	T	A	2: 181,797,739	D393E	possibly damaging	Het
Mzb1	A	T	18: 35,647,848	I129N	probably damaging	Het
Nek10	A	G	14: 14,826,955	D51G	probably benign	Het
Nme5	A	G	18: 34,567,148	I148T	probably benign	Het
Nr2e1	G	A	10: 42,563,479	P348L	probably damaging	Het
Nrp2	A	G	1: 62,719,044	E63G	probably damaging	Het
Olfr594	A	G	7: 103,220,264	E182G	probably damaging	Het
Olfr613	A	T	7: 103,551,749		probably benign	Het
Olfr678	A	G	7: 105,069,497	H10R	probably benign	Het
Olfr679	A	G	7: 105,086,165	T150A	probably benign	Het
Olfr715	A	T	7: 107,128,575	S273T	probably damaging	Het
Pak7	A	G	2: 136,100,964	S419P	probably benign	Het
Pfas	C	A	11: 68,991,095	M25I		Het
Prdm9	A	G	17: 15,544,605	S638P	possibly damaging	Het
Psd	G	A	19: 46,312,913	T954I	possibly damaging	Het
Psph	T	C	5: 129,787,273		probably benign	Het
Ptprf	A	G	4: 118,212,396	I1517T	probably benign	Het
Rassf8	A	G	6: 145,815,403	R152G	probably benign	Het
Rfx3	G	A	19: 27,849,739	T149I	probably benign	Het
Rfx8	A	T	1: 39,683,678	F260I	probably damaging	Het
Rnft1	C	T	11: 86,493,197	Q308*	probably null	Het
Rock2	A	G	12: 16,958,240	N528S	probably benign	Het
Rpp25l	T	C	4: 41,712,305	R157G	unknown	Het
Ryr1	A	T	7: 29,036,103	N4083K	probably damaging	Het
Scd1	G	T	19: 44,400,300	T237N	probably benign	Het
Sema3d	T	C	5: 12,508,145	F215L	probably benign	Het
Sema7a	C	T	9: 57,960,575	T478I	probably benign	Het
Sftpc	T	C	14: 70,522,183	T99A	possibly damaging	Het
Slc25a4	G	A	8: 46,209,204	T139I	probably damaging	Het
Snx27	T	C	3: 94,502,965	E468G	possibly damaging	Het
Snx33	T	C	9: 56,926,774	K4E	possibly damaging	Het
Soat1	A	T	1: 156,440,578	L253*	probably null	Het
Soga1	A	T	2: 157,040,856	D425E	probably benign	Het
Sycp2l	A	T	13: 41,172,716	N749I	probably damaging	Het
Synj2bp	A	T	12: 81,510,890	I47N	probably damaging	Het
Tmem82	T	A	4: 141,616,294	I222F	probably damaging	Het
Ube2o	A	T	11: 116,581,079	L112Q	possibly damaging	Het
Vmn1r204	G	A	13: 22,556,584	W128*	probably null	Het
Vmn2r114	A	T	17: 23,291,843	Y554*	probably null	Het
Vmn2r62	A	T	7: 42,787,789	Y424N	possibly damaging	Het
Vmn2r70	A	T	7: 85,566,104	L74*	probably null	Het
Vmp1	T	A	11: 86,586,551	Y341F	probably benign	Het
Vps13a	A	T	19: 16,725,663	V642D	probably damaging	Het
Vps33a	T	C	5: 123,536,556	M383V	probably benign	Het
Vwf	G	A	6: 125,647,768	V1827I		Het
Zc3hav1	A	G	6: 38,329,186	Y644H	probably benign	Het
Zfp429	A	C	13: 67,390,291	C345G	probably damaging	Het
Zfp595	T	C	13: 67,316,759	H483R	probably benign	Het
Zfp748	G	T	13: 67,542,519	H207Q	probably benign	Het
Zfp758	T	C	17: 22,374,958	S142P	probably damaging	Het
Znfx1	A	C	2: 167,056,225	S260A	probably benign	Het

Other mutations in Inpp5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Inpp5d	APN	1	87683815	missense	probably benign	0.00
IGL00329:Inpp5d	APN	1	87668003	missense	probably benign	0.00
IGL00897:Inpp5d	APN	1	87712114	missense	probably benign	0.14
IGL01314:Inpp5d	APN	1	87683750	nonsense	probably null
IGL02145:Inpp5d	APN	1	87715055	missense	probably damaging	1.00
IGL02422:Inpp5d	APN	1	87708132	missense	probably damaging	1.00
IGL02538:Inpp5d	APN	1	87695366	missense	probably null	0.92
IGL02680:Inpp5d	APN	1	87701483	missense	possibly damaging	0.87
IGL03083:Inpp5d	APN	1	87711141	missense	probably damaging	1.00
IGL03308:Inpp5d	APN	1	87703197	missense	probably damaging	1.00
americas	UTSW	1	87715142	missense	probably damaging	1.00
Apfelsine	UTSW	1	87683845	nonsense	probably null
Auburn	UTSW	1	87681680	splice site	probably null
naranjo	UTSW	1	87708211	critical splice donor site	probably null
New_black	UTSW	1	87709675	missense	probably damaging	1.00
Orange	UTSW	1	87697546	critical splice donor site	probably null
pantone	UTSW	1	87699675	missense	probably damaging	1.00
sailing	UTSW	1	87705964	missense	probably damaging	1.00
Salamander	UTSW	1	87695380	missense	probably damaging	0.99
Sandstone	UTSW	1	87695400	missense	probably damaging	1.00
styx	UTSW	1	87669784	critical splice donor site	probably benign
tangerine	UTSW	1	87705949	missense	probably damaging	1.00
ulster	UTSW	1	87701476	nonsense	probably null
R0010:Inpp5d	UTSW	1	87697546	critical splice donor site	probably null
R0037:Inpp5d	UTSW	1	87708129	missense	probably damaging	0.99
R0087:Inpp5d	UTSW	1	87715138	missense	probably damaging	1.00
R0492:Inpp5d	UTSW	1	87698150	missense	possibly damaging	0.94
R0520:Inpp5d	UTSW	1	87705920	splice site	probably benign
R0733:Inpp5d	UTSW	1	87668077	splice site	probably benign
R1464:Inpp5d	UTSW	1	87698105	splice site	probably benign
R1576:Inpp5d	UTSW	1	87669685	missense	probably benign	0.16
R1576:Inpp5d	UTSW	1	87681558	missense	probably damaging	0.96
R1592:Inpp5d	UTSW	1	87665532	missense	possibly damaging	0.90
R1750:Inpp5d	UTSW	1	87699081	missense	probably damaging	1.00
R1774:Inpp5d	UTSW	1	87667889	missense	probably benign	0.30
R1972:Inpp5d	UTSW	1	87676314	missense	probably benign	0.00
R2024:Inpp5d	UTSW	1	87695350	nonsense	probably null
R2405:Inpp5d	UTSW	1	87699729	missense	possibly damaging	0.94
R3412:Inpp5d	UTSW	1	87668057	missense	possibly damaging	0.93
R3414:Inpp5d	UTSW	1	87668057	missense	possibly damaging	0.93
R3756:Inpp5d	UTSW	1	87701408	splice site	probably benign
R4652:Inpp5d	UTSW	1	87665451	missense	probably benign	0.03
R4676:Inpp5d	UTSW	1	87715142	missense	probably damaging	1.00
R4834:Inpp5d	UTSW	1	87697523	missense	possibly damaging	0.52
R5086:Inpp5d	UTSW	1	87705964	missense	probably damaging	1.00
R5159:Inpp5d	UTSW	1	87676342	missense	probably damaging	1.00
R5250:Inpp5d	UTSW	1	87709675	missense	probably damaging	1.00
R5442:Inpp5d	UTSW	1	87718066	missense	probably benign	0.02
R5875:Inpp5d	UTSW	1	87717974	missense	possibly damaging	0.47
R6135:Inpp5d	UTSW	1	87620397	splice site	probably null
R6371:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6385:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6386:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6526:Inpp5d	UTSW	1	87676250	start gained	probably benign
R6572:Inpp5d	UTSW	1	87695396	missense	probably damaging	0.99
R6831:Inpp5d	UTSW	1	87701476	nonsense	probably null
R6853:Inpp5d	UTSW	1	87681680	splice site	probably null
R6883:Inpp5d	UTSW	1	87699690	missense	probably damaging	0.98
R7082:Inpp5d	UTSW	1	87695380	missense	probably damaging	0.99
R7215:Inpp5d	UTSW	1	87701218	missense	probably benign	0.30
R7418:Inpp5d	UTSW	1	87708211	critical splice donor site	probably null
R7471:Inpp5d	UTSW	1	87695400	missense	probably damaging	1.00
R7716:Inpp5d	UTSW	1	87665399	missense	probably damaging	0.97
R7781:Inpp5d	UTSW	1	87699672	missense	probably damaging	1.00
R7808:Inpp5d	UTSW	1	87683845	nonsense	probably null
R7920:Inpp5d	UTSW	1	87705949	missense	probably damaging	1.00
Z1176:Inpp5d	UTSW	1	87669709	missense	probably benign	0.16
Z1176:Inpp5d	UTSW	1	87703131	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTTGCTTCTGTCTACCACAA -3'
(R):5'- CCCTCAGCAGAAGAAGAACAGGTA -3'

Sequencing Primer
(F):5'- AGTCGAACCTGGTAACTCTGG -3'
(R):5'- TGTGGGGCCAAGGACAG -3'

Posted On

2019-10-24