Incidental Mutation 'R7593:Adamtsl1'
ID587507
Institutional Source Beutler Lab
Gene Symbol Adamtsl1
Ensembl Gene ENSMUSG00000066113
Gene NameADAMTS-like 1
Synonyms5930437A14Rik, 6720426B09Rik, punctin-1
Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R7593 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location85514172-86428385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86341213 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 832 (C832F)
Ref Sequence ENSEMBL: ENSMUSP00000102796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]
Predicted Effect probably damaging
Transcript: ENSMUST00000107178
AA Change: C832F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: C832F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 362 421 2.05e-2 SMART
TSP1 422 476 3.99e-4 SMART
TSP1 508 567 6.39e-3 SMART
TSP1 593 650 7.86e-3 SMART
TSP1 652 712 3.78e-5 SMART
TSP1 715 772 2.66e-2 SMART
TSP1 774 833 1.62e-4 SMART
IGc2 873 937 4.19e-6 SMART
low complexity region 1123 1142 N/A INTRINSIC
IGc2 1175 1240 1.31e-7 SMART
IGc2 1282 1351 7.81e-15 SMART
IGc2 1400 1467 2.39e-10 SMART
TSP1 1481 1537 2.12e-1 SMART
TSP1 1540 1599 1.74e-4 SMART
TSP1 1600 1658 8.2e0 SMART
TSP1 1660 1717 1.96e-1 SMART
Pfam:PLAC 1721 1751 1.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141889
AA Change: C824F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: C824F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 379 438 2.05e-2 SMART
TSP1 439 493 3.99e-4 SMART
TSP1 525 584 6.39e-3 SMART
TSP1 610 667 7.86e-3 SMART
TSP1 707 764 2.66e-2 SMART
TSP1 766 825 1.62e-4 SMART
IGc2 865 929 4.19e-6 SMART
low complexity region 1115 1134 N/A INTRINSIC
IGc2 1167 1232 1.31e-7 SMART
IGc2 1274 1343 7.81e-15 SMART
IGc2 1392 1459 2.39e-10 SMART
TSP1 1473 1529 2.12e-1 SMART
TSP1 1532 1591 1.74e-4 SMART
TSP1 1592 1650 8.2e0 SMART
TSP1 1652 1709 1.96e-1 SMART
Pfam:PLAC 1712 1744 5.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C T 5: 63,898,431 A170V probably damaging Het
Acp6 A T 3: 97,165,950 E102D probably benign Het
Acss1 T A 2: 150,619,768 R632* probably null Het
Adgrg6 T G 10: 14,468,829 M127L probably damaging Het
Alkbh1 A T 12: 87,440,325 Y91* probably null Het
Arhgap35 A T 7: 16,564,861 I93N probably damaging Het
Asic2 A T 11: 81,967,831 D118E probably benign Het
Asprv1 G T 6: 86,628,780 V203L probably damaging Het
Atad2b G A 12: 5,031,726 D1212N probably benign Het
Atp4a A G 7: 30,724,680 I960V probably benign Het
Bin1 G T 18: 32,419,879 E186* probably null Het
Bmp10 A G 6: 87,433,669 Y148C probably damaging Het
Ccdc152 T A 15: 3,280,655 D246V probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cdh9 A T 15: 16,823,175 D81V probably damaging Het
Cep162 A T 9: 87,204,197 S1025T probably benign Het
Cidea A G 18: 67,360,213 I101V probably benign Het
Clock G A 5: 76,236,298 S478L possibly damaging Het
Cp T A 3: 19,966,330 N162K probably benign Het
Crb1 C T 1: 139,237,240 E1110K probably damaging Het
Cyp2b13 A T 7: 26,080,991 I146L possibly damaging Het
D630045J12Rik A G 6: 38,195,494 S580P possibly damaging Het
Dars2 T C 1: 161,057,543 E224G probably damaging Het
Dcbld2 A G 16: 58,424,578 T72A possibly damaging Het
Ddx11 A T 17: 66,126,198 I8F possibly damaging Het
Dennd2d T C 3: 106,499,928 F432L probably damaging Het
Dnah10 T C 5: 124,746,544 V543A probably benign Het
Eef2k G A 7: 120,889,268 probably null Het
Elmo1 A G 13: 20,290,440 M345V probably benign Het
Ephb4 A G 5: 137,361,298 M377V probably benign Het
Erbb4 C A 1: 68,254,599 R711L probably damaging Het
Fads1 A G 19: 10,184,997 E95G probably damaging Het
Farsa G A 8: 84,867,649 probably null Het
Galntl6 A G 8: 57,777,259 S42P probably damaging Het
Gga2 G A 7: 121,990,449 T559M probably benign Het
Glipr1l2 G A 10: 112,092,560 G120D probably damaging Het
Gm14226 A T 2: 155,024,194 I24L unknown Het
Gprc5b G T 7: 118,984,269 R126S probably damaging Het
Gys1 A G 7: 45,442,936 D321G probably damaging Het
Hdlbp C T 1: 93,430,283 A299T probably benign Het
Hic2 A G 16: 17,259,115 T603A probably damaging Het
Hoxa11 A T 6: 52,243,544 I253N probably damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Inpp5d T A 1: 87,717,778 S1023T possibly damaging Het
Kif21a C T 15: 90,943,861 A1233T probably benign Het
Kif9 A T 9: 110,521,353 T771S possibly damaging Het
Klre1 T A 6: 129,583,187 C141S probably damaging Het
Lats1 A G 10: 7,701,712 Y200C probably damaging Het
Lgr4 T A 2: 109,999,456 L247H probably damaging Het
Lrrc37a T C 11: 103,500,952 K1216E probably benign Het
Lrrc41 G A 4: 116,092,944 R518H possibly damaging Het
Lrrk1 A G 7: 66,308,691 V320A probably benign Het
Mcm9 C T 10: 53,629,992 R62H probably benign Het
Mmp10 T G 9: 7,503,153 L38R probably damaging Het
Mroh8 A G 2: 157,229,947 L546P probably damaging Het
Myt1 T A 2: 181,797,739 D393E possibly damaging Het
Mzb1 A T 18: 35,647,848 I129N probably damaging Het
Nek10 A G 14: 14,826,955 D51G probably benign Het
Nme5 A G 18: 34,567,148 I148T probably benign Het
Nr2e1 G A 10: 42,563,479 P348L probably damaging Het
Nrp2 A G 1: 62,719,044 E63G probably damaging Het
Olfr594 A G 7: 103,220,264 E182G probably damaging Het
Olfr613 A T 7: 103,551,749 probably benign Het
Olfr678 A G 7: 105,069,497 H10R probably benign Het
Olfr679 A G 7: 105,086,165 T150A probably benign Het
Olfr715 A T 7: 107,128,575 S273T probably damaging Het
Pak7 A G 2: 136,100,964 S419P probably benign Het
Pfas C A 11: 68,991,095 M25I Het
Prdm9 A G 17: 15,544,605 S638P possibly damaging Het
Psd G A 19: 46,312,913 T954I possibly damaging Het
Psph T C 5: 129,787,273 probably benign Het
Ptprf A G 4: 118,212,396 I1517T probably benign Het
Rassf8 A G 6: 145,815,403 R152G probably benign Het
Rfx3 G A 19: 27,849,739 T149I probably benign Het
Rfx8 A T 1: 39,683,678 F260I probably damaging Het
Rnft1 C T 11: 86,493,197 Q308* probably null Het
Rock2 A G 12: 16,958,240 N528S probably benign Het
Rpp25l T C 4: 41,712,305 R157G unknown Het
Ryr1 A T 7: 29,036,103 N4083K probably damaging Het
Scd1 G T 19: 44,400,300 T237N probably benign Het
Sema3d T C 5: 12,508,145 F215L probably benign Het
Sema7a C T 9: 57,960,575 T478I probably benign Het
Sftpc T C 14: 70,522,183 T99A possibly damaging Het
Slc25a4 G A 8: 46,209,204 T139I probably damaging Het
Snx27 T C 3: 94,502,965 E468G possibly damaging Het
Snx33 T C 9: 56,926,774 K4E possibly damaging Het
Soat1 A T 1: 156,440,578 L253* probably null Het
Soga1 A T 2: 157,040,856 D425E probably benign Het
Sycp2l A T 13: 41,172,716 N749I probably damaging Het
Synj2bp A T 12: 81,510,890 I47N probably damaging Het
Tmem82 T A 4: 141,616,294 I222F probably damaging Het
Ube2o A T 11: 116,581,079 L112Q possibly damaging Het
Vmn1r204 G A 13: 22,556,584 W128* probably null Het
Vmn2r114 A T 17: 23,291,843 Y554* probably null Het
Vmn2r62 A T 7: 42,787,789 Y424N possibly damaging Het
Vmn2r70 A T 7: 85,566,104 L74* probably null Het
Vmp1 T A 11: 86,586,551 Y341F probably benign Het
Vps13a A T 19: 16,725,663 V642D probably damaging Het
Vps33a T C 5: 123,536,556 M383V probably benign Het
Vwf G A 6: 125,647,768 V1827I Het
Zc3hav1 A G 6: 38,329,186 Y644H probably benign Het
Zfp429 A C 13: 67,390,291 C345G probably damaging Het
Zfp595 T C 13: 67,316,759 H483R probably benign Het
Zfp748 G T 13: 67,542,519 H207Q probably benign Het
Zfp758 T C 17: 22,374,958 S142P probably damaging Het
Znfx1 A C 2: 167,056,225 S260A probably benign Het
Other mutations in Adamtsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Adamtsl1 APN 4 86385640 missense probably benign 0.01
IGL00741:Adamtsl1 APN 4 86276948 missense probably damaging 1.00
IGL00770:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00774:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00826:Adamtsl1 APN 4 86156804 missense probably damaging 1.00
IGL00938:Adamtsl1 APN 4 86342278 missense possibly damaging 0.93
IGL01012:Adamtsl1 APN 4 86342189 missense possibly damaging 0.93
IGL01728:Adamtsl1 APN 4 86110837 missense probably damaging 1.00
IGL01801:Adamtsl1 APN 4 86199322 missense probably benign 0.23
IGL01922:Adamtsl1 APN 4 86249902 missense probably damaging 1.00
IGL02006:Adamtsl1 APN 4 86199345 missense probably damaging 1.00
IGL02192:Adamtsl1 APN 4 86228016 missense probably damaging 1.00
IGL02351:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02358:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02373:Adamtsl1 APN 4 86249805 missense probably damaging 1.00
IGL02660:Adamtsl1 APN 4 86232610 missense probably damaging 1.00
IGL02964:Adamtsl1 APN 4 86424357 missense probably damaging 1.00
IGL03233:Adamtsl1 APN 4 86342120 missense probably damaging 1.00
IGL03297:Adamtsl1 APN 4 86423426 missense probably damaging 0.98
IGL03326:Adamtsl1 APN 4 86252748 splice site probably benign
PIT4378001:Adamtsl1 UTSW 4 86199364 missense possibly damaging 0.93
PIT4418001:Adamtsl1 UTSW 4 86243724 missense probably damaging 1.00
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0132:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0453:Adamtsl1 UTSW 4 86232615 missense probably damaging 1.00
R0480:Adamtsl1 UTSW 4 86252818 missense probably benign 0.08
R0496:Adamtsl1 UTSW 4 86341198 missense probably damaging 1.00
R0538:Adamtsl1 UTSW 4 86343121 missense probably benign 0.27
R0547:Adamtsl1 UTSW 4 86356355 missense probably benign 0.37
R0567:Adamtsl1 UTSW 4 86228016 missense probably damaging 1.00
R0568:Adamtsl1 UTSW 4 86418552 missense probably damaging 1.00
R0639:Adamtsl1 UTSW 4 86277143 missense probably damaging 1.00
R0931:Adamtsl1 UTSW 4 86249847 missense probably benign 0.05
R1186:Adamtsl1 UTSW 4 86388509 missense probably benign 0.00
R1387:Adamtsl1 UTSW 4 86374993 splice site probably benign
R1459:Adamtsl1 UTSW 4 86425865 missense probably damaging 1.00
R1518:Adamtsl1 UTSW 4 86342603 missense probably damaging 0.99
R1532:Adamtsl1 UTSW 4 86248065 missense probably benign 0.02
R1603:Adamtsl1 UTSW 4 86415530 missense probably benign
R1931:Adamtsl1 UTSW 4 86342411 missense possibly damaging 0.62
R2086:Adamtsl1 UTSW 4 86228012 missense probably damaging 1.00
R2221:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2223:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2396:Adamtsl1 UTSW 4 86343119 nonsense probably null
R2397:Adamtsl1 UTSW 4 86199357 missense probably damaging 1.00
R2426:Adamtsl1 UTSW 4 86156788 missense probably benign 0.01
R3121:Adamtsl1 UTSW 4 86337009 missense probably damaging 1.00
R3715:Adamtsl1 UTSW 4 86216976 missense probably benign 0.01
R3848:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3849:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3850:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R4194:Adamtsl1 UTSW 4 86054008 intron probably benign
R4354:Adamtsl1 UTSW 4 86156684 missense probably damaging 1.00
R4795:Adamtsl1 UTSW 4 86243769 critical splice donor site probably null
R4830:Adamtsl1 UTSW 4 86356382 missense probably damaging 0.97
R4874:Adamtsl1 UTSW 4 86342492 missense possibly damaging 0.94
R4939:Adamtsl1 UTSW 4 86243725 missense possibly damaging 0.95
R4942:Adamtsl1 UTSW 4 86341214 nonsense probably null
R4947:Adamtsl1 UTSW 4 85764800 missense possibly damaging 0.93
R4960:Adamtsl1 UTSW 4 86424173 nonsense probably null
R4971:Adamtsl1 UTSW 4 86336931 missense probably damaging 1.00
R5141:Adamtsl1 UTSW 4 86156850 missense possibly damaging 0.77
R5213:Adamtsl1 UTSW 4 86385628 missense possibly damaging 0.89
R5237:Adamtsl1 UTSW 4 86385669 critical splice donor site probably null
R5250:Adamtsl1 UTSW 4 86216945 nonsense probably null
R5411:Adamtsl1 UTSW 4 86388413 critical splice acceptor site probably null
R5554:Adamtsl1 UTSW 4 86276945 missense possibly damaging 0.69
R5631:Adamtsl1 UTSW 4 86276923 nonsense probably null
R5739:Adamtsl1 UTSW 4 86232664 missense probably damaging 1.00
R5905:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6028:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6044:Adamtsl1 UTSW 4 86212691 missense probably damaging 1.00
R6261:Adamtsl1 UTSW 4 86336878 missense probably benign 0.09
R6300:Adamtsl1 UTSW 4 86248017 missense probably damaging 1.00
R6332:Adamtsl1 UTSW 4 86217011 missense probably damaging 0.96
R6560:Adamtsl1 UTSW 4 86336893 missense probably damaging 1.00
R6693:Adamtsl1 UTSW 4 86342886 missense probably benign 0.27
R6736:Adamtsl1 UTSW 4 86342247 missense probably damaging 1.00
R6964:Adamtsl1 UTSW 4 86156854 missense probably damaging 1.00
R7064:Adamtsl1 UTSW 4 86342041 missense possibly damaging 0.80
R7434:Adamtsl1 UTSW 4 86425878 missense probably damaging 0.99
R7477:Adamtsl1 UTSW 4 86415651 missense probably damaging 1.00
R7545:Adamtsl1 UTSW 4 85764855 missense probably damaging 1.00
R7556:Adamtsl1 UTSW 4 86277121 missense probably benign 0.19
R7580:Adamtsl1 UTSW 4 86054064 missense possibly damaging 0.53
R7710:Adamtsl1 UTSW 4 86232573 missense
R7908:Adamtsl1 UTSW 4 86356439 missense probably benign 0.02
R7989:Adamtsl1 UTSW 4 86356439 missense probably benign 0.02
R8056:Adamtsl1 UTSW 4 86342032 missense possibly damaging 0.76
Z1176:Adamtsl1 UTSW 4 86342177 missense probably damaging 0.99
Z1176:Adamtsl1 UTSW 4 86342693 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGAGGGACCATTCAGAACAACC -3'
(R):5'- TTTCATCTCCAGTTGGGCAC -3'

Sequencing Primer
(F):5'- CCATGAGACTCTATCTAGTTCAGGG -3'
(R):5'- AGTTGGGCACTCCATCCAC -3'
Posted On2019-10-24