Incidental Mutation 'R0622:Exosc4'
Institutional Source Beutler Lab
Gene Symbol Exosc4
Ensembl Gene ENSMUSG00000034259
Gene Nameexosome component 4
MMRRC Submission 038811-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R0622 (G1)
Quality Score225
Status Not validated
Chromosomal Location76327397-76330677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76327536 bp
Amino Acid Change Aspartic acid to Glycine at position 15 (D15G)
Ref Sequence ENSEMBL: ENSMUSP00000155254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023221] [ENSMUST00000059045] [ENSMUST00000164972] [ENSMUST00000165279] [ENSMUST00000169378] [ENSMUST00000170121] [ENSMUST00000172281] [ENSMUST00000230512]
Predicted Effect probably benign
Transcript: ENSMUST00000023221
SMART Domains Protein: ENSMUSP00000023221
Gene: ENSMUSG00000022561

transmembrane domain 20 42 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Pfam:Gaa1 125 615 3.8e-155 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059045
AA Change: D15G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050940
Gene: ENSMUSG00000034259
AA Change: D15G

Pfam:RNase_PH 21 152 5.1e-37 PFAM
Pfam:RNase_PH_C 155 220 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164680
Predicted Effect probably benign
Transcript: ENSMUST00000164972
SMART Domains Protein: ENSMUSP00000127108
Gene: ENSMUSG00000022561

low complexity region 8 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165279
SMART Domains Protein: ENSMUSP00000127955
Gene: ENSMUSG00000022562

Pfam:Hydant_A_N 9 53 8.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168948
SMART Domains Protein: ENSMUSP00000126326
Gene: ENSMUSG00000022561

Pfam:Gaa1 1 129 1.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169378
SMART Domains Protein: ENSMUSP00000128507
Gene: ENSMUSG00000022561

low complexity region 19 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170121
SMART Domains Protein: ENSMUSP00000133173
Gene: ENSMUSG00000022561

low complexity region 9 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172281
SMART Domains Protein: ENSMUSP00000132986
Gene: ENSMUSG00000022561

signal peptide 1 26 N/A INTRINSIC
Pfam:Gaa1 64 560 3e-205 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230512
AA Change: D15G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230818
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Exosc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Exosc4 APN 15 76329636 missense probably damaging 1.00
R0499:Exosc4 UTSW 15 76329566 missense probably benign 0.01
R0718:Exosc4 UTSW 15 76329489 missense probably benign 0.01
R0733:Exosc4 UTSW 15 76329416 missense probably benign
R0930:Exosc4 UTSW 15 76327534 missense probably benign 0.13
R4881:Exosc4 UTSW 15 76329570 missense probably damaging 1.00
R6560:Exosc4 UTSW 15 76327613 missense probably benign 0.00
R8247:Exosc4 UTSW 15 76329079 missense probably damaging 0.99
R8269:Exosc4 UTSW 15 76327532 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acctgtgtgagatgctttctg -3'
Posted On2013-07-11