Incidental Mutation 'R0622:Exosc4'
ID 58751
Institutional Source Beutler Lab
Gene Symbol Exosc4
Ensembl Gene ENSMUSG00000034259
Gene Name exosome component 4
Synonyms 1500001N04Rik, 1110039I09Rik
MMRRC Submission 038811-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R0622 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 76211597-76214870 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76211736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 15 (D15G)
Ref Sequence ENSEMBL: ENSMUSP00000155254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023221] [ENSMUST00000059045] [ENSMUST00000164972] [ENSMUST00000165279] [ENSMUST00000230512] [ENSMUST00000170121] [ENSMUST00000169378] [ENSMUST00000172281]
AlphaFold Q921I9
Predicted Effect probably benign
Transcript: ENSMUST00000023221
SMART Domains Protein: ENSMUSP00000023221
Gene: ENSMUSG00000022561

transmembrane domain 20 42 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Pfam:Gaa1 125 615 3.8e-155 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059045
AA Change: D15G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050940
Gene: ENSMUSG00000034259
AA Change: D15G

Pfam:RNase_PH 21 152 5.1e-37 PFAM
Pfam:RNase_PH_C 155 220 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164680
Predicted Effect probably benign
Transcript: ENSMUST00000164972
SMART Domains Protein: ENSMUSP00000127108
Gene: ENSMUSG00000022561

low complexity region 8 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165279
SMART Domains Protein: ENSMUSP00000127955
Gene: ENSMUSG00000022562

Pfam:Hydant_A_N 9 53 8.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167515
Predicted Effect probably damaging
Transcript: ENSMUST00000230512
AA Change: D15G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168948
SMART Domains Protein: ENSMUSP00000126326
Gene: ENSMUSG00000022561

Pfam:Gaa1 1 129 1.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170121
SMART Domains Protein: ENSMUSP00000133173
Gene: ENSMUSG00000022561

low complexity region 9 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230818
Predicted Effect probably benign
Transcript: ENSMUST00000169378
SMART Domains Protein: ENSMUSP00000128507
Gene: ENSMUSG00000022561

low complexity region 19 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172281
SMART Domains Protein: ENSMUSP00000132986
Gene: ENSMUSG00000022561

signal peptide 1 26 N/A INTRINSIC
Pfam:Gaa1 64 560 3e-205 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,565,664 (GRCm39) M243K probably benign Het
Ap1b1 A G 11: 4,987,707 (GRCm39) M744V probably damaging Het
Ccdc152 T C 15: 3,327,660 (GRCm39) N39S probably damaging Het
Cd163 G A 6: 124,294,311 (GRCm39) V490M probably damaging Het
Col6a5 G T 9: 105,803,051 (GRCm39) H1305N unknown Het
Cpb1 C A 3: 20,303,982 (GRCm39) D361Y probably damaging Het
Dchs1 T A 7: 105,412,656 (GRCm39) Y1248F probably damaging Het
Dhdds G C 4: 133,721,547 (GRCm39) F83L probably damaging Het
Dsg4 T A 18: 20,582,845 (GRCm39) V161E possibly damaging Het
F3 A T 3: 121,518,668 (GRCm39) D44V probably damaging Het
Fat2 A T 11: 55,173,954 (GRCm39) F2253Y probably damaging Het
Fbn1 T C 2: 125,220,944 (GRCm39) D650G possibly damaging Het
Gramd4 T A 15: 85,975,590 (GRCm39) F36I probably damaging Het
Grm7 G A 6: 111,335,457 (GRCm39) A623T probably damaging Het
Gys1 A T 7: 45,089,419 (GRCm39) T193S probably damaging Het
Hectd4 A G 5: 121,486,688 (GRCm39) T3228A possibly damaging Het
Itpk1 G T 12: 102,540,239 (GRCm39) D281E probably damaging Het
Kcnh7 A C 2: 62,667,633 (GRCm39) probably null Het
Klhl29 A G 12: 5,131,224 (GRCm39) L852P probably damaging Het
Lrch1 T C 14: 75,033,491 (GRCm39) Y509C probably benign Het
Lrp1b A G 2: 41,618,563 (GRCm39) probably null Het
Mcpt4 C A 14: 56,298,119 (GRCm39) R144L probably benign Het
Mia2 C T 12: 59,178,364 (GRCm39) R12W probably damaging Het
Mrps5 A G 2: 127,436,451 (GRCm39) K116R probably benign Het
Myrf G A 19: 10,200,816 (GRCm39) P286S probably damaging Het
Nanp A G 2: 150,881,164 (GRCm39) M28T probably benign Het
Neb T C 2: 52,102,963 (GRCm39) I4472V probably benign Het
Nfix A C 8: 85,453,111 (GRCm39) N314K probably damaging Het
Nlrc3 C T 16: 3,771,832 (GRCm39) R849Q probably benign Het
Nup210l G A 3: 90,075,047 (GRCm39) V786M probably damaging Het
Or2t44 T C 11: 58,677,167 (GRCm39) S36P probably damaging Het
Or52ad1 A G 7: 102,996,064 (GRCm39) S24P probably damaging Het
Or6z5 T C 7: 6,477,598 (GRCm39) I163T possibly damaging Het
Or8c20 A G 9: 38,260,667 (GRCm39) N96S possibly damaging Het
Pdia4 A T 6: 47,783,452 (GRCm39) F197Y probably damaging Het
Phldb1 T C 9: 44,627,149 (GRCm39) D432G probably damaging Het
Pik3ca A G 3: 32,490,701 (GRCm39) E116G probably damaging Het
Polq T C 16: 36,881,355 (GRCm39) V1173A probably benign Het
Pou2f3 C T 9: 43,036,414 (GRCm39) R423H probably damaging Het
Pramel29 T C 4: 143,939,583 (GRCm39) probably benign Het
Prkag2 T C 5: 25,074,247 (GRCm39) N246S probably damaging Het
Proser1 A G 3: 53,385,281 (GRCm39) S388G probably benign Het
Ralgps1 G A 2: 33,064,459 (GRCm39) R238* probably null Het
Rfx2 T C 17: 57,084,071 (GRCm39) D657G probably damaging Het
Ryr3 A G 2: 112,492,900 (GRCm39) F3724S probably damaging Het
Sh2d5 T C 4: 137,986,539 (GRCm39) S421P probably damaging Het
Slc34a1 C A 13: 23,996,594 (GRCm39) T33K probably damaging Het
St8sia5 A G 18: 77,333,809 (GRCm39) T156A probably damaging Het
Stk32c T C 7: 138,768,026 (GRCm39) D85G probably benign Het
Tnks A G 8: 35,407,976 (GRCm39) S251P probably damaging Het
Tnxb T A 17: 34,937,703 (GRCm39) L3864Q probably damaging Het
Trim9 A G 12: 70,393,378 (GRCm39) Y189H probably damaging Het
Vmn1r77 T G 7: 11,775,315 (GRCm39) F30L probably benign Het
Wasf3 A G 5: 146,403,602 (GRCm39) probably null Het
Wdr90 C T 17: 26,074,632 (GRCm39) C603Y probably damaging Het
Zdhhc25 T C 15: 88,485,310 (GRCm39) L215P probably damaging Het
Zeb1 C T 18: 5,759,123 (GRCm39) Q140* probably null Het
Zfp677 C T 17: 21,617,962 (GRCm39) L340F probably benign Het
Other mutations in Exosc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Exosc4 APN 15 76,213,836 (GRCm39) missense probably damaging 1.00
R0499:Exosc4 UTSW 15 76,213,766 (GRCm39) missense probably benign 0.01
R0718:Exosc4 UTSW 15 76,213,689 (GRCm39) missense probably benign 0.01
R0733:Exosc4 UTSW 15 76,213,616 (GRCm39) missense probably benign
R0930:Exosc4 UTSW 15 76,211,734 (GRCm39) missense probably benign 0.13
R4881:Exosc4 UTSW 15 76,213,770 (GRCm39) missense probably damaging 1.00
R6560:Exosc4 UTSW 15 76,211,813 (GRCm39) missense probably benign 0.00
R8247:Exosc4 UTSW 15 76,213,279 (GRCm39) missense probably damaging 0.99
R8269:Exosc4 UTSW 15 76,211,732 (GRCm39) missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acctgtgtgagatgctttctg -3'
Posted On 2013-07-11