Incidental Mutation 'R7593:Zc3hav1'
ID587519
Institutional Source Beutler Lab
Gene Symbol Zc3hav1
Ensembl Gene ENSMUSG00000029826
Gene Namezinc finger CCCH type, antiviral 1
Synonyms9130009D18Rik, 2900058M19Rik, ZAP, 1200014N16Rik, 9830115L13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7593 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location38305286-38354603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38329186 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 644 (Y644H)
Ref Sequence ENSEMBL: ENSMUSP00000144312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031850] [ENSMUST00000114898] [ENSMUST00000114900] [ENSMUST00000143702]
Predicted Effect probably benign
Transcript: ENSMUST00000031850
AA Change: Y644H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031850
Gene: ENSMUSG00000029826
AA Change: Y644H

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 9.6e-6 PROSPERO
internal_repeat_1 166 208 9.6e-6 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114898
AA Change: Y528H

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110548
Gene: ENSMUSG00000029826
AA Change: Y528H

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 8.18e-6 PROSPERO
internal_repeat_1 166 208 8.18e-6 PROSPERO
low complexity region 338 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114900
AA Change: Y644H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000110550
Gene: ENSMUSG00000029826
AA Change: Y644H

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.94e-5 PROSPERO
internal_repeat_1 166 208 1.94e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 2.8e-15 PFAM
Pfam:PARP 817 986 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143702
AA Change: Y644H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000144312
Gene: ENSMUSG00000029826
AA Change: Y644H

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.8e-5 PROSPERO
internal_repeat_1 166 208 1.8e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 1e-15 PFAM
Pfam:PARP 817 922 1.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CCCH-type zinc finger protein that is thought to prevent infection by retroviruses. Studies of the rat homolog indicate that the protein may primarily function to inhibit viral gene expression and induce an innate immunity to viral infection. Alternative splicing occurs at this locus and two variants, each encoding distinct isoforms, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced murine leukemia virus replication efficiency in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C T 5: 63,898,431 A170V probably damaging Het
Acp6 A T 3: 97,165,950 E102D probably benign Het
Acss1 T A 2: 150,619,768 R632* probably null Het
Adamtsl1 G T 4: 86,341,213 C832F probably damaging Het
Adgrg6 T G 10: 14,468,829 M127L probably damaging Het
Alkbh1 A T 12: 87,440,325 Y91* probably null Het
Arhgap35 A T 7: 16,564,861 I93N probably damaging Het
Asic2 A T 11: 81,967,831 D118E probably benign Het
Asprv1 G T 6: 86,628,780 V203L probably damaging Het
Atad2b G A 12: 5,031,726 D1212N probably benign Het
Atp4a A G 7: 30,724,680 I960V probably benign Het
Bin1 G T 18: 32,419,879 E186* probably null Het
Bmp10 A G 6: 87,433,669 Y148C probably damaging Het
Ccdc152 T A 15: 3,280,655 D246V probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cdh9 A T 15: 16,823,175 D81V probably damaging Het
Cep162 A T 9: 87,204,197 S1025T probably benign Het
Cidea A G 18: 67,360,213 I101V probably benign Het
Clock G A 5: 76,236,298 S478L possibly damaging Het
Cp T A 3: 19,966,330 N162K probably benign Het
Crb1 C T 1: 139,237,240 E1110K probably damaging Het
Cyp2b13 A T 7: 26,080,991 I146L possibly damaging Het
D630045J12Rik A G 6: 38,195,494 S580P possibly damaging Het
Dars2 T C 1: 161,057,543 E224G probably damaging Het
Dcbld2 A G 16: 58,424,578 T72A possibly damaging Het
Ddx11 A T 17: 66,126,198 I8F possibly damaging Het
Dennd2d T C 3: 106,499,928 F432L probably damaging Het
Dnah10 T C 5: 124,746,544 V543A probably benign Het
Eef2k G A 7: 120,889,268 probably null Het
Elmo1 A G 13: 20,290,440 M345V probably benign Het
Ephb4 A G 5: 137,361,298 M377V probably benign Het
Erbb4 C A 1: 68,254,599 R711L probably damaging Het
Fads1 A G 19: 10,184,997 E95G probably damaging Het
Farsa G A 8: 84,867,649 probably null Het
Galntl6 A G 8: 57,777,259 S42P probably damaging Het
Gga2 G A 7: 121,990,449 T559M probably benign Het
Glipr1l2 G A 10: 112,092,560 G120D probably damaging Het
Gm14226 A T 2: 155,024,194 I24L unknown Het
Gprc5b G T 7: 118,984,269 R126S probably damaging Het
Gys1 A G 7: 45,442,936 D321G probably damaging Het
Hdlbp C T 1: 93,430,283 A299T probably benign Het
Hic2 A G 16: 17,259,115 T603A probably damaging Het
Hoxa11 A T 6: 52,243,544 I253N probably damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Inpp5d T A 1: 87,717,778 S1023T possibly damaging Het
Kif21a C T 15: 90,943,861 A1233T probably benign Het
Kif9 A T 9: 110,521,353 T771S possibly damaging Het
Klre1 T A 6: 129,583,187 C141S probably damaging Het
Lats1 A G 10: 7,701,712 Y200C probably damaging Het
Lgr4 T A 2: 109,999,456 L247H probably damaging Het
Lrrc37a T C 11: 103,500,952 K1216E probably benign Het
Lrrc41 G A 4: 116,092,944 R518H possibly damaging Het
Lrrk1 A G 7: 66,308,691 V320A probably benign Het
Mcm9 C T 10: 53,629,992 R62H probably benign Het
Mmp10 T G 9: 7,503,153 L38R probably damaging Het
Mroh8 A G 2: 157,229,947 L546P probably damaging Het
Myt1 T A 2: 181,797,739 D393E possibly damaging Het
Mzb1 A T 18: 35,647,848 I129N probably damaging Het
Nek10 A G 14: 14,826,955 D51G probably benign Het
Nme5 A G 18: 34,567,148 I148T probably benign Het
Nr2e1 G A 10: 42,563,479 P348L probably damaging Het
Nrp2 A G 1: 62,719,044 E63G probably damaging Het
Olfr594 A G 7: 103,220,264 E182G probably damaging Het
Olfr613 A T 7: 103,551,749 probably benign Het
Olfr678 A G 7: 105,069,497 H10R probably benign Het
Olfr679 A G 7: 105,086,165 T150A probably benign Het
Olfr715 A T 7: 107,128,575 S273T probably damaging Het
Pak7 A G 2: 136,100,964 S419P probably benign Het
Pfas C A 11: 68,991,095 M25I Het
Prdm9 A G 17: 15,544,605 S638P possibly damaging Het
Psd G A 19: 46,312,913 T954I possibly damaging Het
Psph T C 5: 129,787,273 probably benign Het
Ptprf A G 4: 118,212,396 I1517T probably benign Het
Rassf8 A G 6: 145,815,403 R152G probably benign Het
Rfx3 G A 19: 27,849,739 T149I probably benign Het
Rfx8 A T 1: 39,683,678 F260I probably damaging Het
Rnft1 C T 11: 86,493,197 Q308* probably null Het
Rock2 A G 12: 16,958,240 N528S probably benign Het
Rpp25l T C 4: 41,712,305 R157G unknown Het
Ryr1 A T 7: 29,036,103 N4083K probably damaging Het
Scd1 G T 19: 44,400,300 T237N probably benign Het
Sema3d T C 5: 12,508,145 F215L probably benign Het
Sema7a C T 9: 57,960,575 T478I probably benign Het
Sftpc T C 14: 70,522,183 T99A possibly damaging Het
Slc25a4 G A 8: 46,209,204 T139I probably damaging Het
Snx27 T C 3: 94,502,965 E468G possibly damaging Het
Snx33 T C 9: 56,926,774 K4E possibly damaging Het
Soat1 A T 1: 156,440,578 L253* probably null Het
Soga1 A T 2: 157,040,856 D425E probably benign Het
Sycp2l A T 13: 41,172,716 N749I probably damaging Het
Synj2bp A T 12: 81,510,890 I47N probably damaging Het
Tmem82 T A 4: 141,616,294 I222F probably damaging Het
Ube2o A T 11: 116,581,079 L112Q possibly damaging Het
Vmn1r204 G A 13: 22,556,584 W128* probably null Het
Vmn2r114 A T 17: 23,291,843 Y554* probably null Het
Vmn2r62 A T 7: 42,787,789 Y424N possibly damaging Het
Vmn2r70 A T 7: 85,566,104 L74* probably null Het
Vmp1 T A 11: 86,586,551 Y341F probably benign Het
Vps13a A T 19: 16,725,663 V642D probably damaging Het
Vps33a T C 5: 123,536,556 M383V probably benign Het
Vwf G A 6: 125,647,768 V1827I Het
Zfp429 A C 13: 67,390,291 C345G probably damaging Het
Zfp595 T C 13: 67,316,759 H483R probably benign Het
Zfp748 G T 13: 67,542,519 H207Q probably benign Het
Zfp758 T C 17: 22,374,958 S142P probably damaging Het
Znfx1 A C 2: 167,056,225 S260A probably benign Het
Other mutations in Zc3hav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Zc3hav1 APN 6 38319833 splice site probably null
IGL02225:Zc3hav1 APN 6 38340341 missense probably damaging 1.00
IGL02266:Zc3hav1 APN 6 38332168 missense probably benign 0.01
IGL02458:Zc3hav1 APN 6 38340329 missense probably damaging 1.00
IGL02626:Zc3hav1 APN 6 38332991 missense probably damaging 0.96
IGL02725:Zc3hav1 APN 6 38332192 missense probably damaging 0.98
IGL02958:Zc3hav1 APN 6 38332984 missense probably damaging 1.00
IGL03104:Zc3hav1 APN 6 38340343 missense probably damaging 1.00
IGL03137:Zc3hav1 APN 6 38332394 missense probably benign
IGL03238:Zc3hav1 APN 6 38332750 missense probably damaging 0.99
IGL03380:Zc3hav1 APN 6 38336558 missense probably damaging 1.00
IGL03055:Zc3hav1 UTSW 6 38316316 splice site probably null
P0038:Zc3hav1 UTSW 6 38332534 missense probably damaging 0.98
R0006:Zc3hav1 UTSW 6 38319702 critical splice donor site probably null
R0207:Zc3hav1 UTSW 6 38311174 missense probably benign 0.00
R0255:Zc3hav1 UTSW 6 38336550 missense probably damaging 1.00
R0452:Zc3hav1 UTSW 6 38307437 missense probably benign 0.01
R0505:Zc3hav1 UTSW 6 38332664 missense probably damaging 1.00
R0865:Zc3hav1 UTSW 6 38353902 splice site probably benign
R1281:Zc3hav1 UTSW 6 38353937 missense probably damaging 1.00
R1531:Zc3hav1 UTSW 6 38307235 missense possibly damaging 0.91
R1873:Zc3hav1 UTSW 6 38332757 missense possibly damaging 0.50
R1991:Zc3hav1 UTSW 6 38336517 missense probably damaging 1.00
R2149:Zc3hav1 UTSW 6 38336537 missense probably damaging 1.00
R2184:Zc3hav1 UTSW 6 38307408 missense probably damaging 0.99
R2365:Zc3hav1 UTSW 6 38340233 missense probably damaging 1.00
R2924:Zc3hav1 UTSW 6 38354110 missense probably damaging 0.97
R3237:Zc3hav1 UTSW 6 38319715 missense probably damaging 1.00
R3710:Zc3hav1 UTSW 6 38332162 missense probably benign 0.35
R5683:Zc3hav1 UTSW 6 38307237 missense probably damaging 1.00
R5684:Zc3hav1 UTSW 6 38311279 missense probably benign 0.01
R5905:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R5959:Zc3hav1 UTSW 6 38307444 missense probably benign 0.01
R6028:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R6261:Zc3hav1 UTSW 6 38333000 missense probably benign 0.24
R6465:Zc3hav1 UTSW 6 38331849 missense possibly damaging 0.85
R6682:Zc3hav1 UTSW 6 38325195 missense probably benign 0.02
R6831:Zc3hav1 UTSW 6 38332168 missense probably benign 0.01
R7082:Zc3hav1 UTSW 6 38332393 nonsense probably null
R7196:Zc3hav1 UTSW 6 38329272 missense probably benign
R7248:Zc3hav1 UTSW 6 38353976 missense probably benign 0.04
R7319:Zc3hav1 UTSW 6 38332274 missense probably benign
R7506:Zc3hav1 UTSW 6 38332940 nonsense probably null
R7788:Zc3hav1 UTSW 6 38332756 missense probably benign 0.02
R7885:Zc3hav1 UTSW 6 38336663 missense possibly damaging 0.82
R7892:Zc3hav1 UTSW 6 38329221 missense probably benign 0.25
R7968:Zc3hav1 UTSW 6 38336663 missense possibly damaging 0.82
R7975:Zc3hav1 UTSW 6 38329221 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TACTAAGAGCATGGCCCGAC -3'
(R):5'- GGTCTTGACAGGAAGCCAGTAG -3'

Sequencing Primer
(F):5'- ACTGTGCTTTTCCAGGGGACAC -3'
(R):5'- CCAGTAGTGAACTTGAACAGTGAAC -3'
Posted On2019-10-24