Incidental Mutation 'R7593:Vwf'
ID 587523
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms 6820430P06Rik, B130011O06Rik
Accession Numbers

Genbank: NM_011708; MGI: 98941
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R7593 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 125546774-125686679 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 125647768 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1827 (V1827I)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: V1827I

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147101
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C T 5: 63,898,431 A170V probably damaging Het
Acp6 A T 3: 97,165,950 E102D probably benign Het
Acss1 T A 2: 150,619,768 R632* probably null Het
Adamtsl1 G T 4: 86,341,213 C832F probably damaging Het
Adgrg6 T G 10: 14,468,829 M127L probably damaging Het
Alkbh1 A T 12: 87,440,325 Y91* probably null Het
Arhgap35 A T 7: 16,564,861 I93N probably damaging Het
Asic2 A T 11: 81,967,831 D118E probably benign Het
Asprv1 G T 6: 86,628,780 V203L probably damaging Het
Atad2b G A 12: 5,031,726 D1212N probably benign Het
Atp4a A G 7: 30,724,680 I960V probably benign Het
Bin1 G T 18: 32,419,879 E186* probably null Het
Bmp10 A G 6: 87,433,669 Y148C probably damaging Het
Ccdc152 T A 15: 3,280,655 D246V probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cdh9 A T 15: 16,823,175 D81V probably damaging Het
Cep162 A T 9: 87,204,197 S1025T probably benign Het
Cidea A G 18: 67,360,213 I101V probably benign Het
Clock G A 5: 76,236,298 S478L possibly damaging Het
Cp T A 3: 19,966,330 N162K probably benign Het
Crb1 C T 1: 139,237,240 E1110K probably damaging Het
Cyp2b13 A T 7: 26,080,991 I146L possibly damaging Het
D630045J12Rik A G 6: 38,195,494 S580P possibly damaging Het
Dars2 T C 1: 161,057,543 E224G probably damaging Het
Dcbld2 A G 16: 58,424,578 T72A possibly damaging Het
Ddx11 A T 17: 66,126,198 I8F possibly damaging Het
Dennd2d T C 3: 106,499,928 F432L probably damaging Het
Dnah10 T C 5: 124,746,544 V543A probably benign Het
Eef2k G A 7: 120,889,268 probably null Het
Elmo1 A G 13: 20,290,440 M345V probably benign Het
Ephb4 A G 5: 137,361,298 M377V probably benign Het
Erbb4 C A 1: 68,254,599 R711L probably damaging Het
Fads1 A G 19: 10,184,997 E95G probably damaging Het
Farsa G A 8: 84,867,649 probably null Het
Galntl6 A G 8: 57,777,259 S42P probably damaging Het
Gga2 G A 7: 121,990,449 T559M probably benign Het
Glipr1l2 G A 10: 112,092,560 G120D probably damaging Het
Gm14226 A T 2: 155,024,194 I24L unknown Het
Gprc5b G T 7: 118,984,269 R126S probably damaging Het
Gys1 A G 7: 45,442,936 D321G probably damaging Het
Hdlbp C T 1: 93,430,283 A299T probably benign Het
Hic2 A G 16: 17,259,115 T603A probably damaging Het
Hoxa11 A T 6: 52,243,544 I253N probably damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Inpp5d T A 1: 87,717,778 S1023T possibly damaging Het
Kif21a C T 15: 90,943,861 A1233T probably benign Het
Kif9 A T 9: 110,521,353 T771S possibly damaging Het
Klre1 T A 6: 129,583,187 C141S probably damaging Het
Lats1 A G 10: 7,701,712 Y200C probably damaging Het
Lgr4 T A 2: 109,999,456 L247H probably damaging Het
Lrrc37a T C 11: 103,500,952 K1216E probably benign Het
Lrrc41 G A 4: 116,092,944 R518H possibly damaging Het
Lrrk1 A G 7: 66,308,691 V320A probably benign Het
Mcm9 C T 10: 53,629,992 R62H probably benign Het
Mmp10 T G 9: 7,503,153 L38R probably damaging Het
Mroh8 A G 2: 157,229,947 L546P probably damaging Het
Myt1 T A 2: 181,797,739 D393E possibly damaging Het
Mzb1 A T 18: 35,647,848 I129N probably damaging Het
Nek10 A G 14: 14,826,955 D51G probably benign Het
Nme5 A G 18: 34,567,148 I148T probably benign Het
Nr2e1 G A 10: 42,563,479 P348L probably damaging Het
Nrp2 A G 1: 62,719,044 E63G probably damaging Het
Olfr594 A G 7: 103,220,264 E182G probably damaging Het
Olfr613 A T 7: 103,551,749 probably benign Het
Olfr678 A G 7: 105,069,497 H10R probably benign Het
Olfr679 A G 7: 105,086,165 T150A probably benign Het
Olfr715 A T 7: 107,128,575 S273T probably damaging Het
Pak7 A G 2: 136,100,964 S419P probably benign Het
Pfas C A 11: 68,991,095 M25I Het
Prdm9 A G 17: 15,544,605 S638P possibly damaging Het
Psd G A 19: 46,312,913 T954I possibly damaging Het
Psph T C 5: 129,787,273 probably benign Het
Ptprf A G 4: 118,212,396 I1517T probably benign Het
Rassf8 A G 6: 145,815,403 R152G probably benign Het
Rfx3 G A 19: 27,849,739 T149I probably benign Het
Rfx8 A T 1: 39,683,678 F260I probably damaging Het
Rnft1 C T 11: 86,493,197 Q308* probably null Het
Rock2 A G 12: 16,958,240 N528S probably benign Het
Rpp25l T C 4: 41,712,305 R157G unknown Het
Ryr1 A T 7: 29,036,103 N4083K probably damaging Het
Scd1 G T 19: 44,400,300 T237N probably benign Het
Sema3d T C 5: 12,508,145 F215L probably benign Het
Sema7a C T 9: 57,960,575 T478I probably benign Het
Sftpc T C 14: 70,522,183 T99A possibly damaging Het
Slc25a4 G A 8: 46,209,204 T139I probably damaging Het
Snx27 T C 3: 94,502,965 E468G possibly damaging Het
Snx33 T C 9: 56,926,774 K4E possibly damaging Het
Soat1 A T 1: 156,440,578 L253* probably null Het
Soga1 A T 2: 157,040,856 D425E probably benign Het
Sycp2l A T 13: 41,172,716 N749I probably damaging Het
Synj2bp A T 12: 81,510,890 I47N probably damaging Het
Tmem82 T A 4: 141,616,294 I222F probably damaging Het
Ube2o A T 11: 116,581,079 L112Q possibly damaging Het
Vmn1r204 G A 13: 22,556,584 W128* probably null Het
Vmn2r114 A T 17: 23,291,843 Y554* probably null Het
Vmn2r62 A T 7: 42,787,789 Y424N possibly damaging Het
Vmn2r70 A T 7: 85,566,104 L74* probably null Het
Vmp1 T A 11: 86,586,551 Y341F probably benign Het
Vps13a A T 19: 16,725,663 V642D probably damaging Het
Vps33a T C 5: 123,536,556 M383V probably benign Het
Zc3hav1 A G 6: 38,329,186 Y644H probably benign Het
Zfp429 A C 13: 67,390,291 C345G probably damaging Het
Zfp595 T C 13: 67,316,759 H483R probably benign Het
Zfp748 G T 13: 67,542,519 H207Q probably benign Het
Zfp758 T C 17: 22,374,958 S142P probably damaging Het
Znfx1 A C 2: 167,056,225 S260A probably benign Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
gingerman UTSW 6 125662963 critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125685837 missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125663571 nonsense probably null
R1628_Vwf_608 UTSW 6 125647738 unclassified probably benign
R1669_Vwf_448 UTSW 6 125647906 missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125642037 missense probably benign 0.14
R2130_vwf_946 UTSW 6 125657057 missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125683526 missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125628476 critical splice donor site probably null
Russiahouse UTSW 6 125639341 nonsense probably null
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
R8853:Vwf UTSW 6 125657264 missense
R9027:Vwf UTSW 6 125666663 missense
R9065:Vwf UTSW 6 125646299 missense
R9068:Vwf UTSW 6 125648829 unclassified probably benign
R9128:Vwf UTSW 6 125642730 missense
R9136:Vwf UTSW 6 125599393 splice site probably benign
R9164:Vwf UTSW 6 125565843 missense
R9177:Vwf UTSW 6 125604291 missense
R9334:Vwf UTSW 6 125677946 missense
R9508:Vwf UTSW 6 125555508 missense
R9553:Vwf UTSW 6 125600699 missense
R9660:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9706:Vwf UTSW 6 125624573 missense
R9708:Vwf UTSW 6 125657090 missense
R9712:Vwf UTSW 6 125624573 missense
R9714:Vwf UTSW 6 125624573 missense
R9728:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9758:Vwf UTSW 6 125626267 missense
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTTTGCATGCTCCAGACCT -3'
(R):5'- AGTGGTTGCTTGAGAACTGAAA -3'

Sequencing Primer
(F):5'- TGTGCCTGATACACAGCAGTAGC -3'
(R):5'- TTGCTTGAGAACTGAAAAAGGAAAC -3'
Posted On 2019-10-24