Incidental Mutation 'R7593:Arhgap35'
ID587526
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7593 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16564861 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 93 (I93N)
Ref Sequence ENSEMBL: ENSMUSP00000075242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect probably damaging
Transcript: ENSMUST00000075845
AA Change: I93N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: I93N

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171937
AA Change: I93N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: I93N

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C T 5: 63,898,431 A170V probably damaging Het
Acp6 A T 3: 97,165,950 E102D probably benign Het
Acss1 T A 2: 150,619,768 R632* probably null Het
Adamtsl1 G T 4: 86,341,213 C832F probably damaging Het
Adgrg6 T G 10: 14,468,829 M127L probably damaging Het
Alkbh1 A T 12: 87,440,325 Y91* probably null Het
Asic2 A T 11: 81,967,831 D118E probably benign Het
Asprv1 G T 6: 86,628,780 V203L probably damaging Het
Atad2b G A 12: 5,031,726 D1212N probably benign Het
Atp4a A G 7: 30,724,680 I960V probably benign Het
Bin1 G T 18: 32,419,879 E186* probably null Het
Bmp10 A G 6: 87,433,669 Y148C probably damaging Het
Ccdc152 T A 15: 3,280,655 D246V probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cdh9 A T 15: 16,823,175 D81V probably damaging Het
Cep162 A T 9: 87,204,197 S1025T probably benign Het
Cidea A G 18: 67,360,213 I101V probably benign Het
Clock G A 5: 76,236,298 S478L possibly damaging Het
Cp T A 3: 19,966,330 N162K probably benign Het
Crb1 C T 1: 139,237,240 E1110K probably damaging Het
Cyp2b13 A T 7: 26,080,991 I146L possibly damaging Het
D630045J12Rik A G 6: 38,195,494 S580P possibly damaging Het
Dars2 T C 1: 161,057,543 E224G probably damaging Het
Dcbld2 A G 16: 58,424,578 T72A possibly damaging Het
Ddx11 A T 17: 66,126,198 I8F possibly damaging Het
Dennd2d T C 3: 106,499,928 F432L probably damaging Het
Dnah10 T C 5: 124,746,544 V543A probably benign Het
Eef2k G A 7: 120,889,268 probably null Het
Elmo1 A G 13: 20,290,440 M345V probably benign Het
Ephb4 A G 5: 137,361,298 M377V probably benign Het
Erbb4 C A 1: 68,254,599 R711L probably damaging Het
Fads1 A G 19: 10,184,997 E95G probably damaging Het
Farsa G A 8: 84,867,649 probably null Het
Galntl6 A G 8: 57,777,259 S42P probably damaging Het
Gga2 G A 7: 121,990,449 T559M probably benign Het
Glipr1l2 G A 10: 112,092,560 G120D probably damaging Het
Gm14226 A T 2: 155,024,194 I24L unknown Het
Gprc5b G T 7: 118,984,269 R126S probably damaging Het
Gys1 A G 7: 45,442,936 D321G probably damaging Het
Hdlbp C T 1: 93,430,283 A299T probably benign Het
Hic2 A G 16: 17,259,115 T603A probably damaging Het
Hoxa11 A T 6: 52,243,544 I253N probably damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Inpp5d T A 1: 87,717,778 S1023T possibly damaging Het
Kif21a C T 15: 90,943,861 A1233T probably benign Het
Kif9 A T 9: 110,521,353 T771S possibly damaging Het
Klre1 T A 6: 129,583,187 C141S probably damaging Het
Lats1 A G 10: 7,701,712 Y200C probably damaging Het
Lgr4 T A 2: 109,999,456 L247H probably damaging Het
Lrrc37a T C 11: 103,500,952 K1216E probably benign Het
Lrrc41 G A 4: 116,092,944 R518H possibly damaging Het
Lrrk1 A G 7: 66,308,691 V320A probably benign Het
Mcm9 C T 10: 53,629,992 R62H probably benign Het
Mmp10 T G 9: 7,503,153 L38R probably damaging Het
Mroh8 A G 2: 157,229,947 L546P probably damaging Het
Myt1 T A 2: 181,797,739 D393E possibly damaging Het
Mzb1 A T 18: 35,647,848 I129N probably damaging Het
Nek10 A G 14: 14,826,955 D51G probably benign Het
Nme5 A G 18: 34,567,148 I148T probably benign Het
Nr2e1 G A 10: 42,563,479 P348L probably damaging Het
Nrp2 A G 1: 62,719,044 E63G probably damaging Het
Olfr594 A G 7: 103,220,264 E182G probably damaging Het
Olfr613 A T 7: 103,551,749 probably benign Het
Olfr678 A G 7: 105,069,497 H10R probably benign Het
Olfr679 A G 7: 105,086,165 T150A probably benign Het
Olfr715 A T 7: 107,128,575 S273T probably damaging Het
Pak7 A G 2: 136,100,964 S419P probably benign Het
Pfas C A 11: 68,991,095 M25I Het
Prdm9 A G 17: 15,544,605 S638P possibly damaging Het
Psd G A 19: 46,312,913 T954I possibly damaging Het
Psph T C 5: 129,787,273 probably benign Het
Ptprf A G 4: 118,212,396 I1517T probably benign Het
Rassf8 A G 6: 145,815,403 R152G probably benign Het
Rfx3 G A 19: 27,849,739 T149I probably benign Het
Rfx8 A T 1: 39,683,678 F260I probably damaging Het
Rnft1 C T 11: 86,493,197 Q308* probably null Het
Rock2 A G 12: 16,958,240 N528S probably benign Het
Rpp25l T C 4: 41,712,305 R157G unknown Het
Ryr1 A T 7: 29,036,103 N4083K probably damaging Het
Scd1 G T 19: 44,400,300 T237N probably benign Het
Sema3d T C 5: 12,508,145 F215L probably benign Het
Sema7a C T 9: 57,960,575 T478I probably benign Het
Sftpc T C 14: 70,522,183 T99A possibly damaging Het
Slc25a4 G A 8: 46,209,204 T139I probably damaging Het
Snx27 T C 3: 94,502,965 E468G possibly damaging Het
Snx33 T C 9: 56,926,774 K4E possibly damaging Het
Soat1 A T 1: 156,440,578 L253* probably null Het
Soga1 A T 2: 157,040,856 D425E probably benign Het
Sycp2l A T 13: 41,172,716 N749I probably damaging Het
Synj2bp A T 12: 81,510,890 I47N probably damaging Het
Tmem82 T A 4: 141,616,294 I222F probably damaging Het
Ube2o A T 11: 116,581,079 L112Q possibly damaging Het
Vmn1r204 G A 13: 22,556,584 W128* probably null Het
Vmn2r114 A T 17: 23,291,843 Y554* probably null Het
Vmn2r62 A T 7: 42,787,789 Y424N possibly damaging Het
Vmn2r70 A T 7: 85,566,104 L74* probably null Het
Vmp1 T A 11: 86,586,551 Y341F probably benign Het
Vps13a A T 19: 16,725,663 V642D probably damaging Het
Vps33a T C 5: 123,536,556 M383V probably benign Het
Vwf G A 6: 125,647,768 V1827I Het
Zc3hav1 A G 6: 38,329,186 Y644H probably benign Het
Zfp429 A C 13: 67,390,291 C345G probably damaging Het
Zfp595 T C 13: 67,316,759 H483R probably benign Het
Zfp748 G T 13: 67,542,519 H207Q probably benign Het
Zfp758 T C 17: 22,374,958 S142P probably damaging Het
Znfx1 A C 2: 167,056,225 S260A probably benign Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16561611 missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16563281 missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16563133 missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16564738 missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16563586 missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5175:Arhgap35 UTSW 7 16562599 missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
R8101:Arhgap35 UTSW 7 16562319 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCCTGCTAACATCAATGC -3'
(R):5'- GAAGTCTTGTCTGTGTAACCGC -3'

Sequencing Primer
(F):5'- ACCAGCAGCTTCCCATCTGG -3'
(R):5'- GCTTTGTGCGCCCAAGTG -3'
Posted On2019-10-24