Mutagenetix > Incidental Mutation

Incidental Mutation 'R7593:Lrrk1'

587533

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7593 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66308691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 320 (V320A)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277]

AlphaFold

Q3UHC2

Predicted Effect

probably benign
Transcript: ENSMUST00000015277
AA Change: V320A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: V320A

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207140

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	T	5: 63,898,431	A170V	probably damaging	Het
Acp6	A	T	3: 97,165,950	E102D	probably benign	Het
Acss1	T	A	2: 150,619,768	R632*	probably null	Het
Adamtsl1	G	T	4: 86,341,213	C832F	probably damaging	Het
Adgrg6	T	G	10: 14,468,829	M127L	probably damaging	Het
Alkbh1	A	T	12: 87,440,325	Y91*	probably null	Het
Arhgap35	A	T	7: 16,564,861	I93N	probably damaging	Het
Asic2	A	T	11: 81,967,831	D118E	probably benign	Het
Asprv1	G	T	6: 86,628,780	V203L	probably damaging	Het
Atad2b	G	A	12: 5,031,726	D1212N	probably benign	Het
Atp4a	A	G	7: 30,724,680	I960V	probably benign	Het
Bin1	G	T	18: 32,419,879	E186*	probably null	Het
Bmp10	A	G	6: 87,433,669	Y148C	probably damaging	Het
Ccdc152	T	A	15: 3,280,655	D246V	probably damaging	Het
Cdc16	A	G	8: 13,777,605	T504A	probably benign	Het
Cdh9	A	T	15: 16,823,175	D81V	probably damaging	Het
Cep162	A	T	9: 87,204,197	S1025T	probably benign	Het
Cidea	A	G	18: 67,360,213	I101V	probably benign	Het
Clock	G	A	5: 76,236,298	S478L	possibly damaging	Het
Cp	T	A	3: 19,966,330	N162K	probably benign	Het
Crb1	C	T	1: 139,237,240	E1110K	probably damaging	Het
Cyp2b13	A	T	7: 26,080,991	I146L	possibly damaging	Het
D630045J12Rik	A	G	6: 38,195,494	S580P	possibly damaging	Het
Dars2	T	C	1: 161,057,543	E224G	probably damaging	Het
Dcbld2	A	G	16: 58,424,578	T72A	possibly damaging	Het
Ddx11	A	T	17: 66,126,198	I8F	possibly damaging	Het
Dennd2d	T	C	3: 106,499,928	F432L	probably damaging	Het
Dnah10	T	C	5: 124,746,544	V543A	probably benign	Het
Eef2k	G	A	7: 120,889,268		probably null	Het
Elmo1	A	G	13: 20,290,440	M345V	probably benign	Het
Ephb4	A	G	5: 137,361,298	M377V	probably benign	Het
Erbb4	C	A	1: 68,254,599	R711L	probably damaging	Het
Fads1	A	G	19: 10,184,997	E95G	probably damaging	Het
Farsa	G	A	8: 84,867,649		probably null	Het
Galntl6	A	G	8: 57,777,259	S42P	probably damaging	Het
Gga2	G	A	7: 121,990,449	T559M	probably benign	Het
Glipr1l2	G	A	10: 112,092,560	G120D	probably damaging	Het
Gm14226	A	T	2: 155,024,194	I24L	unknown	Het
Gprc5b	G	T	7: 118,984,269	R126S	probably damaging	Het
Gys1	A	G	7: 45,442,936	D321G	probably damaging	Het
Hdlbp	C	T	1: 93,430,283	A299T	probably benign	Het
Hic2	A	G	16: 17,259,115	T603A	probably damaging	Het
Hoxa11	A	T	6: 52,243,544	I253N	probably damaging	Het
Iglon5	A	T	7: 43,476,640	D222E	probably benign	Het
Inpp5d	T	A	1: 87,717,778	S1023T	possibly damaging	Het
Kif21a	C	T	15: 90,943,861	A1233T	probably benign	Het
Kif9	A	T	9: 110,521,353	T771S	possibly damaging	Het
Klre1	T	A	6: 129,583,187	C141S	probably damaging	Het
Lats1	A	G	10: 7,701,712	Y200C	probably damaging	Het
Lgr4	T	A	2: 109,999,456	L247H	probably damaging	Het
Lrrc37a	T	C	11: 103,500,952	K1216E	probably benign	Het
Lrrc41	G	A	4: 116,092,944	R518H	possibly damaging	Het
Mcm9	C	T	10: 53,629,992	R62H	probably benign	Het
Mmp10	T	G	9: 7,503,153	L38R	probably damaging	Het
Mroh8	A	G	2: 157,229,947	L546P	probably damaging	Het
Myt1	T	A	2: 181,797,739	D393E	possibly damaging	Het
Mzb1	A	T	18: 35,647,848	I129N	probably damaging	Het
Nek10	A	G	14: 14,826,955	D51G	probably benign	Het
Nme5	A	G	18: 34,567,148	I148T	probably benign	Het
Nr2e1	G	A	10: 42,563,479	P348L	probably damaging	Het
Nrp2	A	G	1: 62,719,044	E63G	probably damaging	Het
Olfr594	A	G	7: 103,220,264	E182G	probably damaging	Het
Olfr613	A	T	7: 103,551,749		probably benign	Het
Olfr678	A	G	7: 105,069,497	H10R	probably benign	Het
Olfr679	A	G	7: 105,086,165	T150A	probably benign	Het
Olfr715	A	T	7: 107,128,575	S273T	probably damaging	Het
Pak7	A	G	2: 136,100,964	S419P	probably benign	Het
Pfas	C	A	11: 68,991,095	M25I		Het
Prdm9	A	G	17: 15,544,605	S638P	possibly damaging	Het
Psd	G	A	19: 46,312,913	T954I	possibly damaging	Het
Psph	T	C	5: 129,787,273		probably benign	Het
Ptprf	A	G	4: 118,212,396	I1517T	probably benign	Het
Rassf8	A	G	6: 145,815,403	R152G	probably benign	Het
Rfx3	G	A	19: 27,849,739	T149I	probably benign	Het
Rfx8	A	T	1: 39,683,678	F260I	probably damaging	Het
Rnft1	C	T	11: 86,493,197	Q308*	probably null	Het
Rock2	A	G	12: 16,958,240	N528S	probably benign	Het
Rpp25l	T	C	4: 41,712,305	R157G	unknown	Het
Ryr1	A	T	7: 29,036,103	N4083K	probably damaging	Het
Scd1	G	T	19: 44,400,300	T237N	probably benign	Het
Sema3d	T	C	5: 12,508,145	F215L	probably benign	Het
Sema7a	C	T	9: 57,960,575	T478I	probably benign	Het
Sftpc	T	C	14: 70,522,183	T99A	possibly damaging	Het
Slc25a4	G	A	8: 46,209,204	T139I	probably damaging	Het
Snx27	T	C	3: 94,502,965	E468G	possibly damaging	Het
Snx33	T	C	9: 56,926,774	K4E	possibly damaging	Het
Soat1	A	T	1: 156,440,578	L253*	probably null	Het
Soga1	A	T	2: 157,040,856	D425E	probably benign	Het
Sycp2l	A	T	13: 41,172,716	N749I	probably damaging	Het
Synj2bp	A	T	12: 81,510,890	I47N	probably damaging	Het
Tmem82	T	A	4: 141,616,294	I222F	probably damaging	Het
Ube2o	A	T	11: 116,581,079	L112Q	possibly damaging	Het
Vmn1r204	G	A	13: 22,556,584	W128*	probably null	Het
Vmn2r114	A	T	17: 23,291,843	Y554*	probably null	Het
Vmn2r62	A	T	7: 42,787,789	Y424N	possibly damaging	Het
Vmn2r70	A	T	7: 85,566,104	L74*	probably null	Het
Vmp1	T	A	11: 86,586,551	Y341F	probably benign	Het
Vps13a	A	T	19: 16,725,663	V642D	probably damaging	Het
Vps33a	T	C	5: 123,536,556	M383V	probably benign	Het
Vwf	G	A	6: 125,647,768	V1827I		Het
Zc3hav1	A	G	6: 38,329,186	Y644H	probably benign	Het
Zfp429	A	C	13: 67,390,291	C345G	probably damaging	Het
Zfp595	T	C	13: 67,316,759	H483R	probably benign	Het
Zfp748	G	T	13: 67,542,519	H207Q	probably benign	Het
Zfp758	T	C	17: 22,374,958	S142P	probably damaging	Het
Znfx1	A	C	2: 167,056,225	S260A	probably benign	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
R8690:Lrrk1	UTSW	7	66302729	missense	probably benign	0.02
R8955:Lrrk1	UTSW	7	66269825	missense	probably benign	0.09
R9135:Lrrk1	UTSW	7	66278609	missense	probably damaging	1.00
R9380:Lrrk1	UTSW	7	66278583	missense	probably damaging	1.00
R9625:Lrrk1	UTSW	7	66259918	makesense	probably null
R9721:Lrrk1	UTSW	7	66274875	missense	probably damaging	1.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ACTTCTCTGGCTCCTAAGGG -3'
(R):5'- CGTGTGAAATGGTCCCATCTG -3'

Sequencing Primer
(F):5'- TGGCTCCTAAGGGGTCAGAGATC -3'
(R):5'- GAAATGGTCCCATCTGAAGTTGCC -3'

Posted On

2019-10-24