Mutagenetix > Incidental Mutations

Incidental Mutation 'R0622:Nlrc3'

58754

Institutional Source

Beutler Lab

Gene Symbol

Nlrc3

Ensembl Gene

ENSMUSG00000049871

Gene Name

NLR family, CARD domain containing 3

Synonyms

CLR16.2, Caterpiller 16.2, D230007K08Rik

MMRRC Submission

038811-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R0622 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3945007-3976632 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 3953968 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 849 (R849Q)

Ref Sequence

ENSEMBL: ENSMUSP00000155241 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000177551] [ENSMUST00000180200] [ENSMUST00000229884]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000096308

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163478

Predicted Effect

probably benign
Transcript: ENSMUST00000177551
AA Change: R865Q

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871
AA Change: R865Q

Domain	Start	End	E-Value	Type
Pfam:NACHT	176	342	2e-34	PFAM
LRR	702	729	3.11e-2	SMART
LRR	730	757	2.27e-4	SMART
LRR	758	785	8.15e-1	SMART
LRR	786	813	2.17e-1	SMART
LRR	814	841	2.12e-4	SMART
LRR	842	869	3.42e0	SMART
LRR	870	897	7.67e-2	SMART
LRR	898	925	3.21e0	SMART
LRR	926	953	1.67e0	SMART
LRR	954	981	4.87e-4	SMART
LRR	982	1009	4.3e0	SMART
LRR	1010	1037	3.8e-6	SMART
LRR	1038	1065	4.47e-3	SMART
LRR	1066	1093	1.08e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000180200
AA Change: R160Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871
AA Change: R160Q

Domain	Start	End	E-Value	Type
LRR	4	24	8.65e1	SMART
LRR	25	52	2.27e-4	SMART
LRR	53	80	8.15e-1	SMART
LRR	81	108	2.17e-1	SMART
LRR	109	136	2.12e-4	SMART
LRR	137	164	3.42e0	SMART
LRR	165	192	7.67e-2	SMART
LRR	193	220	3.21e0	SMART
LRR	221	248	1.67e0	SMART
LRR	249	276	4.87e-4	SMART
LRR	277	304	4.3e0	SMART
LRR	305	332	3.8e-6	SMART
LRR	333	360	4.47e-3	SMART
LRR	361	388	1.08e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229884
AA Change: R849Q

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a NOD-like receptor family member. The encoded protein is a cytosolic regulator of innate immunity. This protein directly interacts with stimulator of interferon genes (STING), to prevent its proper trafficking, resulting in disruption of STING-dependent activation of the innate immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced susceptibility to LPS-induced toxic shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtr1a	T	A	13: 30,381,681	M243K	probably benign	Het
Ap1b1	A	G	11: 5,037,707	M744V	probably damaging	Het
C87977	T	C	4: 144,213,013		probably benign	Het
Ccdc152	T	C	15: 3,298,178	N39S	probably damaging	Het
Cd163	G	A	6: 124,317,352	V490M	probably damaging	Het
Col6a5	G	T	9: 105,925,852	H1305N	unknown	Het
Cpb1	C	A	3: 20,249,818	D361Y	probably damaging	Het
Dchs1	T	A	7: 105,763,449	Y1248F	probably damaging	Het
Dhdds	G	C	4: 133,994,236	F83L	probably damaging	Het
Dsg4	T	A	18: 20,449,788	V161E	possibly damaging	Het
Exosc4	A	G	15: 76,327,536	D15G	probably damaging	Het
F3	A	T	3: 121,725,019	D44V	probably damaging	Het
Fat2	A	T	11: 55,283,128	F2253Y	probably damaging	Het
Fbn1	T	C	2: 125,379,024	D650G	possibly damaging	Het
Gramd4	T	A	15: 86,091,389	F36I	probably damaging	Het
Grm7	G	A	6: 111,358,496	A623T	probably damaging	Het
Gys1	A	T	7: 45,439,995	T193S	probably damaging	Het
Hectd4	A	G	5: 121,348,625	T3228A	possibly damaging	Het
Itpk1	G	T	12: 102,573,980	D281E	probably damaging	Het
Kcnh7	A	C	2: 62,837,289		probably null	Het
Klhl29	A	G	12: 5,081,224	L852P	probably damaging	Het
Lrch1	T	C	14: 74,796,051	Y509C	probably benign	Het
Lrp1b	A	G	2: 41,728,551		probably null	Het
Mcpt4	C	A	14: 56,060,662	R144L	probably benign	Het
Mia2	C	T	12: 59,131,578	R12W	probably damaging	Het
Mrps5	A	G	2: 127,594,531	K116R	probably benign	Het
Myrf	G	A	19: 10,223,452	P286S	probably damaging	Het
Nanp	A	G	2: 151,039,244	M28T	probably benign	Het
Neb	T	C	2: 52,212,951	I4472V	probably benign	Het
Nfix	A	C	8: 84,726,482	N314K	probably damaging	Het
Nup210l	G	A	3: 90,167,740	V786M	probably damaging	Het
Olfr1346	T	C	7: 6,474,599	I163T	possibly damaging	Het
Olfr314	T	C	11: 58,786,341	S36P	probably damaging	Het
Olfr600	A	G	7: 103,346,857	S24P	probably damaging	Het
Olfr898	A	G	9: 38,349,371	N96S	possibly damaging	Het
Pdia4	A	T	6: 47,806,518	F197Y	probably damaging	Het
Phldb1	T	C	9: 44,715,852	D432G	probably damaging	Het
Pik3ca	A	G	3: 32,436,552	E116G	probably damaging	Het
Polq	T	C	16: 37,060,993	V1173A	probably benign	Het
Pou2f3	C	T	9: 43,125,119	R423H	probably damaging	Het
Prkag2	T	C	5: 24,869,249	N246S	probably damaging	Het
Proser1	A	G	3: 53,477,860	S388G	probably benign	Het
Ralgps1	G	A	2: 33,174,447	R238*	probably null	Het
Rfx2	T	C	17: 56,777,071	D657G	probably damaging	Het
Ryr3	A	G	2: 112,662,555	F3724S	probably damaging	Het
Sh2d5	T	C	4: 138,259,228	S421P	probably damaging	Het
Slc17a2	C	A	13: 23,812,611	T33K	probably damaging	Het
St8sia5	A	G	18: 77,246,113	T156A	probably damaging	Het
Stk32c	T	C	7: 139,188,110	D85G	probably benign	Het
Tnks	A	G	8: 34,940,822	S251P	probably damaging	Het
Tnxb	T	A	17: 34,718,729	L3864Q	probably damaging	Het
Trim9	A	G	12: 70,346,604	Y189H	probably damaging	Het
Vmn1r77	T	G	7: 12,041,388	F30L	probably benign	Het
Wasf3	A	G	5: 146,466,792		probably null	Het
Wdr90	C	T	17: 25,855,658	C603Y	probably damaging	Het
Zdhhc25	T	C	15: 88,601,107	L215P	probably damaging	Het
Zeb1	C	T	18: 5,759,123	Q140*	probably null	Het
Zfp677	C	T	17: 21,397,700	L340F	probably benign	Het

Other mutations in Nlrc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Nlrc3	APN	16	3955166	missense	probably damaging	1.00
IGL00943:Nlrc3	APN	16	3965117	missense	possibly damaging	0.94
IGL01481:Nlrc3	APN	16	3963905	missense	probably damaging	1.00
IGL01517:Nlrc3	APN	16	3947487	missense	probably damaging	0.99
IGL01988:Nlrc3	APN	16	3953939	missense	probably benign	0.43
IGL02306:Nlrc3	APN	16	3964824	missense	probably damaging	1.00
IGL02515:Nlrc3	APN	16	3949459	splice site	probably benign
IGL02795:Nlrc3	APN	16	3965285	missense	probably damaging	0.99
IGL02897:Nlrc3	APN	16	3964074	missense	possibly damaging	0.85
IGL02992:Nlrc3	APN	16	3954023	splice site	probably benign
IGL03003:Nlrc3	APN	16	3964862	missense	probably benign	0.03
IGL03381:Nlrc3	APN	16	3964315	missense	probably benign	0.03
R0064:Nlrc3	UTSW	16	3964087	missense	possibly damaging	0.82
R0064:Nlrc3	UTSW	16	3964087	missense	possibly damaging	0.82
R0122:Nlrc3	UTSW	16	3958958	missense	probably damaging	0.98
R0482:Nlrc3	UTSW	16	3965192	missense	possibly damaging	0.81
R0601:Nlrc3	UTSW	16	3948249	splice site	probably benign
R0675:Nlrc3	UTSW	16	3948911	missense	probably benign	0.01
R1595:Nlrc3	UTSW	16	3965302	missense	probably benign	0.03
R1597:Nlrc3	UTSW	16	3963995	missense	probably damaging	1.00
R2013:Nlrc3	UTSW	16	3965110	missense	probably damaging	1.00
R2077:Nlrc3	UTSW	16	3963992	missense	probably benign	0.35
R2327:Nlrc3	UTSW	16	3953440	missense	probably damaging	1.00
R2872:Nlrc3	UTSW	16	3957326	missense	possibly damaging	0.56
R2872:Nlrc3	UTSW	16	3957326	missense	possibly damaging	0.56
R3037:Nlrc3	UTSW	16	3952408	missense	probably damaging	1.00
R3794:Nlrc3	UTSW	16	3947875	missense	probably benign	0.22
R3843:Nlrc3	UTSW	16	3964964	missense	probably benign
R4761:Nlrc3	UTSW	16	3963650	missense	probably damaging	1.00
R5303:Nlrc3	UTSW	16	3963614	missense	probably benign	0.15
R5375:Nlrc3	UTSW	16	3964753	missense	possibly damaging	0.95
R5468:Nlrc3	UTSW	16	3964035	missense	probably damaging	1.00
R5719:Nlrc3	UTSW	16	3963725	missense	probably damaging	1.00
R5838:Nlrc3	UTSW	16	3953995	missense	probably damaging	1.00
R5879:Nlrc3	UTSW	16	3964045	missense	probably damaging	1.00
R5942:Nlrc3	UTSW	16	3949429	missense	probably damaging	1.00
R6500:Nlrc3	UTSW	16	3952444	missense	possibly damaging	0.79
R6600:Nlrc3	UTSW	16	3965074	missense	probably benign	0.29
R6704:Nlrc3	UTSW	16	3965081	missense	probably damaging	0.99
R7172:Nlrc3	UTSW	16	3963753	missense	probably benign	0.30
R7283:Nlrc3	UTSW	16	3947877	missense	probably benign	0.25
R7296:Nlrc3	UTSW	16	3963590	missense	probably damaging	0.99
R7477:Nlrc3	UTSW	16	3964811	missense	probably damaging	0.99
R7817:Nlrc3	UTSW	16	3965463	missense	possibly damaging	0.87
R8118:Nlrc3	UTSW	16	3965631	missense	probably benign
R8559:Nlrc3	UTSW	16	3965282	missense	probably benign	0.05
R8871:Nlrc3	UTSW	16	3964104	intron	probably benign
R9008:Nlrc3	UTSW	16	3958943	missense	possibly damaging	0.95
R9237:Nlrc3	UTSW	16	3965209	missense	probably benign	0.02
R9385:Nlrc3	UTSW	16	3964012	missense	probably damaging	1.00
R9430:Nlrc3	UTSW	16	3965532

Predicted Primers

PCR Primer
(F):5'- TCTGCACTGCCGACAGTCTAGAAC -3'
(R):5'- CTGCAAACCTCAGGGCTTATCTCC -3'

Sequencing Primer
(F):5'- TGGCACCTGAAGGACTTATAC -3'
(R):5'- TAGGACAGGCTAAGTCTCCTGG -3'

Posted On

2013-07-11