Mutagenetix > Incidental Mutation

Incidental Mutation 'R7593:Lats1'

587552

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R7593 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7701712 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 200 (Y200C)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: Y200C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: Y200C

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: Y200C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: Y200C

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: Y200C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	T	5: 63,898,431	A170V	probably damaging	Het
Acp6	A	T	3: 97,165,950	E102D	probably benign	Het
Acss1	T	A	2: 150,619,768	R632*	probably null	Het
Adamtsl1	G	T	4: 86,341,213	C832F	probably damaging	Het
Adgrg6	T	G	10: 14,468,829	M127L	probably damaging	Het
Alkbh1	A	T	12: 87,440,325	Y91*	probably null	Het
Arhgap35	A	T	7: 16,564,861	I93N	probably damaging	Het
Asic2	A	T	11: 81,967,831	D118E	probably benign	Het
Asprv1	G	T	6: 86,628,780	V203L	probably damaging	Het
Atad2b	G	A	12: 5,031,726	D1212N	probably benign	Het
Atp4a	A	G	7: 30,724,680	I960V	probably benign	Het
Bin1	G	T	18: 32,419,879	E186*	probably null	Het
Bmp10	A	G	6: 87,433,669	Y148C	probably damaging	Het
Ccdc152	T	A	15: 3,280,655	D246V	probably damaging	Het
Cdc16	A	G	8: 13,777,605	T504A	probably benign	Het
Cdh9	A	T	15: 16,823,175	D81V	probably damaging	Het
Cep162	A	T	9: 87,204,197	S1025T	probably benign	Het
Cidea	A	G	18: 67,360,213	I101V	probably benign	Het
Clock	G	A	5: 76,236,298	S478L	possibly damaging	Het
Cp	T	A	3: 19,966,330	N162K	probably benign	Het
Crb1	C	T	1: 139,237,240	E1110K	probably damaging	Het
Cyp2b13	A	T	7: 26,080,991	I146L	possibly damaging	Het
D630045J12Rik	A	G	6: 38,195,494	S580P	possibly damaging	Het
Dars2	T	C	1: 161,057,543	E224G	probably damaging	Het
Dcbld2	A	G	16: 58,424,578	T72A	possibly damaging	Het
Ddx11	A	T	17: 66,126,198	I8F	possibly damaging	Het
Dennd2d	T	C	3: 106,499,928	F432L	probably damaging	Het
Dnah10	T	C	5: 124,746,544	V543A	probably benign	Het
Eef2k	G	A	7: 120,889,268		probably null	Het
Elmo1	A	G	13: 20,290,440	M345V	probably benign	Het
Ephb4	A	G	5: 137,361,298	M377V	probably benign	Het
Erbb4	C	A	1: 68,254,599	R711L	probably damaging	Het
Fads1	A	G	19: 10,184,997	E95G	probably damaging	Het
Farsa	G	A	8: 84,867,649		probably null	Het
Galntl6	A	G	8: 57,777,259	S42P	probably damaging	Het
Gga2	G	A	7: 121,990,449	T559M	probably benign	Het
Glipr1l2	G	A	10: 112,092,560	G120D	probably damaging	Het
Gm14226	A	T	2: 155,024,194	I24L	unknown	Het
Gprc5b	G	T	7: 118,984,269	R126S	probably damaging	Het
Gys1	A	G	7: 45,442,936	D321G	probably damaging	Het
Hdlbp	C	T	1: 93,430,283	A299T	probably benign	Het
Hic2	A	G	16: 17,259,115	T603A	probably damaging	Het
Hoxa11	A	T	6: 52,243,544	I253N	probably damaging	Het
Iglon5	A	T	7: 43,476,640	D222E	probably benign	Het
Inpp5d	T	A	1: 87,717,778	S1023T	possibly damaging	Het
Kif21a	C	T	15: 90,943,861	A1233T	probably benign	Het
Kif9	A	T	9: 110,521,353	T771S	possibly damaging	Het
Klre1	T	A	6: 129,583,187	C141S	probably damaging	Het
Lgr4	T	A	2: 109,999,456	L247H	probably damaging	Het
Lrrc37a	T	C	11: 103,500,952	K1216E	probably benign	Het
Lrrc41	G	A	4: 116,092,944	R518H	possibly damaging	Het
Lrrk1	A	G	7: 66,308,691	V320A	probably benign	Het
Mcm9	C	T	10: 53,629,992	R62H	probably benign	Het
Mmp10	T	G	9: 7,503,153	L38R	probably damaging	Het
Mroh8	A	G	2: 157,229,947	L546P	probably damaging	Het
Myt1	T	A	2: 181,797,739	D393E	possibly damaging	Het
Mzb1	A	T	18: 35,647,848	I129N	probably damaging	Het
Nek10	A	G	14: 14,826,955	D51G	probably benign	Het
Nme5	A	G	18: 34,567,148	I148T	probably benign	Het
Nr2e1	G	A	10: 42,563,479	P348L	probably damaging	Het
Nrp2	A	G	1: 62,719,044	E63G	probably damaging	Het
Olfr594	A	G	7: 103,220,264	E182G	probably damaging	Het
Olfr613	A	T	7: 103,551,749		probably benign	Het
Olfr678	A	G	7: 105,069,497	H10R	probably benign	Het
Olfr679	A	G	7: 105,086,165	T150A	probably benign	Het
Olfr715	A	T	7: 107,128,575	S273T	probably damaging	Het
Pak7	A	G	2: 136,100,964	S419P	probably benign	Het
Pfas	C	A	11: 68,991,095	M25I		Het
Prdm9	A	G	17: 15,544,605	S638P	possibly damaging	Het
Psd	G	A	19: 46,312,913	T954I	possibly damaging	Het
Psph	T	C	5: 129,787,273		probably benign	Het
Ptprf	A	G	4: 118,212,396	I1517T	probably benign	Het
Rassf8	A	G	6: 145,815,403	R152G	probably benign	Het
Rfx3	G	A	19: 27,849,739	T149I	probably benign	Het
Rfx8	A	T	1: 39,683,678	F260I	probably damaging	Het
Rnft1	C	T	11: 86,493,197	Q308*	probably null	Het
Rock2	A	G	12: 16,958,240	N528S	probably benign	Het
Rpp25l	T	C	4: 41,712,305	R157G	unknown	Het
Ryr1	A	T	7: 29,036,103	N4083K	probably damaging	Het
Scd1	G	T	19: 44,400,300	T237N	probably benign	Het
Sema3d	T	C	5: 12,508,145	F215L	probably benign	Het
Sema7a	C	T	9: 57,960,575	T478I	probably benign	Het
Sftpc	T	C	14: 70,522,183	T99A	possibly damaging	Het
Slc25a4	G	A	8: 46,209,204	T139I	probably damaging	Het
Snx27	T	C	3: 94,502,965	E468G	possibly damaging	Het
Snx33	T	C	9: 56,926,774	K4E	possibly damaging	Het
Soat1	A	T	1: 156,440,578	L253*	probably null	Het
Soga1	A	T	2: 157,040,856	D425E	probably benign	Het
Sycp2l	A	T	13: 41,172,716	N749I	probably damaging	Het
Synj2bp	A	T	12: 81,510,890	I47N	probably damaging	Het
Tmem82	T	A	4: 141,616,294	I222F	probably damaging	Het
Ube2o	A	T	11: 116,581,079	L112Q	possibly damaging	Het
Vmn1r204	G	A	13: 22,556,584	W128*	probably null	Het
Vmn2r114	A	T	17: 23,291,843	Y554*	probably null	Het
Vmn2r62	A	T	7: 42,787,789	Y424N	possibly damaging	Het
Vmn2r70	A	T	7: 85,566,104	L74*	probably null	Het
Vmp1	T	A	11: 86,586,551	Y341F	probably benign	Het
Vps13a	A	T	19: 16,725,663	V642D	probably damaging	Het
Vps33a	T	C	5: 123,536,556	M383V	probably benign	Het
Vwf	G	A	6: 125,647,768	V1827I		Het
Zc3hav1	A	G	6: 38,329,186	Y644H	probably benign	Het
Zfp429	A	C	13: 67,390,291	C345G	probably damaging	Het
Zfp595	T	C	13: 67,316,759	H483R	probably benign	Het
Zfp748	G	T	13: 67,542,519	H207Q	probably benign	Het
Zfp758	T	C	17: 22,374,958	S142P	probably damaging	Het
Znfx1	A	C	2: 167,056,225	S260A	probably benign	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTATTCCAGACCCTTTGAGGAC -3'
(R):5'- CTGAGAGCTTGGTTCCCATGAG -3'

Sequencing Primer
(F):5'- CATAGGTCCTCTGTAAGAGCAGC -3'
(R):5'- AGGGGGAGTGGTGCCTC -3'

Posted On

2019-10-24